ID: 1019502207

View in Genome Browser
Species Human (GRCh38)
Location 7:1369935-1369957
Sequence TGGGGGAGCAATCCCATTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019502207_1019502226 28 Left 1019502207 7:1369935-1369957 CCTGTAATGGGATTGCTCCCCCA No data
Right 1019502226 7:1369986-1370008 ATGGCGGGCAAGGCGGGCAAGGG No data
1019502207_1019502224 22 Left 1019502207 7:1369935-1369957 CCTGTAATGGGATTGCTCCCCCA No data
Right 1019502224 7:1369980-1370002 TATGAGATGGCGGGCAAGGCGGG No data
1019502207_1019502221 13 Left 1019502207 7:1369935-1369957 CCTGTAATGGGATTGCTCCCCCA No data
Right 1019502221 7:1369971-1369993 TGTGTGGGATATGAGATGGCGGG No data
1019502207_1019502219 9 Left 1019502207 7:1369935-1369957 CCTGTAATGGGATTGCTCCCCCA No data
Right 1019502219 7:1369967-1369989 CTGCTGTGTGGGATATGAGATGG No data
1019502207_1019502215 -3 Left 1019502207 7:1369935-1369957 CCTGTAATGGGATTGCTCCCCCA No data
Right 1019502215 7:1369955-1369977 CCAAAAGGGGCCCTGCTGTGTGG No data
1019502207_1019502222 18 Left 1019502207 7:1369935-1369957 CCTGTAATGGGATTGCTCCCCCA No data
Right 1019502222 7:1369976-1369998 GGGATATGAGATGGCGGGCAAGG No data
1019502207_1019502223 21 Left 1019502207 7:1369935-1369957 CCTGTAATGGGATTGCTCCCCCA No data
Right 1019502223 7:1369979-1370001 ATATGAGATGGCGGGCAAGGCGG No data
1019502207_1019502225 27 Left 1019502207 7:1369935-1369957 CCTGTAATGGGATTGCTCCCCCA No data
Right 1019502225 7:1369985-1370007 GATGGCGGGCAAGGCGGGCAAGG No data
1019502207_1019502216 -2 Left 1019502207 7:1369935-1369957 CCTGTAATGGGATTGCTCCCCCA No data
Right 1019502216 7:1369956-1369978 CAAAAGGGGCCCTGCTGTGTGGG No data
1019502207_1019502220 12 Left 1019502207 7:1369935-1369957 CCTGTAATGGGATTGCTCCCCCA No data
Right 1019502220 7:1369970-1369992 CTGTGTGGGATATGAGATGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019502207 Original CRISPR TGGGGGAGCAATCCCATTAC AGG (reversed) Intergenic