ID: 1019502211

View in Genome Browser
Species Human (GRCh38)
Location 7:1369952-1369974
Sequence CACAGCAGGGCCCCTTTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019502211_1019502225 10 Left 1019502211 7:1369952-1369974 CCCCCAAAAGGGGCCCTGCTGTG No data
Right 1019502225 7:1369985-1370007 GATGGCGGGCAAGGCGGGCAAGG No data
1019502211_1019502222 1 Left 1019502211 7:1369952-1369974 CCCCCAAAAGGGGCCCTGCTGTG No data
Right 1019502222 7:1369976-1369998 GGGATATGAGATGGCGGGCAAGG No data
1019502211_1019502227 19 Left 1019502211 7:1369952-1369974 CCCCCAAAAGGGGCCCTGCTGTG No data
Right 1019502227 7:1369994-1370016 CAAGGCGGGCAAGGGATTGCAGG No data
1019502211_1019502226 11 Left 1019502211 7:1369952-1369974 CCCCCAAAAGGGGCCCTGCTGTG No data
Right 1019502226 7:1369986-1370008 ATGGCGGGCAAGGCGGGCAAGGG No data
1019502211_1019502219 -8 Left 1019502211 7:1369952-1369974 CCCCCAAAAGGGGCCCTGCTGTG No data
Right 1019502219 7:1369967-1369989 CTGCTGTGTGGGATATGAGATGG No data
1019502211_1019502221 -4 Left 1019502211 7:1369952-1369974 CCCCCAAAAGGGGCCCTGCTGTG No data
Right 1019502221 7:1369971-1369993 TGTGTGGGATATGAGATGGCGGG No data
1019502211_1019502223 4 Left 1019502211 7:1369952-1369974 CCCCCAAAAGGGGCCCTGCTGTG No data
Right 1019502223 7:1369979-1370001 ATATGAGATGGCGGGCAAGGCGG No data
1019502211_1019502224 5 Left 1019502211 7:1369952-1369974 CCCCCAAAAGGGGCCCTGCTGTG No data
Right 1019502224 7:1369980-1370002 TATGAGATGGCGGGCAAGGCGGG No data
1019502211_1019502220 -5 Left 1019502211 7:1369952-1369974 CCCCCAAAAGGGGCCCTGCTGTG No data
Right 1019502220 7:1369970-1369992 CTGTGTGGGATATGAGATGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019502211 Original CRISPR CACAGCAGGGCCCCTTTTGG GGG (reversed) Intergenic