ID: 1019502212

View in Genome Browser
Species Human (GRCh38)
Location 7:1369953-1369975
Sequence ACACAGCAGGGCCCCTTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019502212_1019502219 -9 Left 1019502212 7:1369953-1369975 CCCCAAAAGGGGCCCTGCTGTGT No data
Right 1019502219 7:1369967-1369989 CTGCTGTGTGGGATATGAGATGG No data
1019502212_1019502224 4 Left 1019502212 7:1369953-1369975 CCCCAAAAGGGGCCCTGCTGTGT No data
Right 1019502224 7:1369980-1370002 TATGAGATGGCGGGCAAGGCGGG No data
1019502212_1019502228 30 Left 1019502212 7:1369953-1369975 CCCCAAAAGGGGCCCTGCTGTGT No data
Right 1019502228 7:1370006-1370028 GGGATTGCAGGCACGTGCTGTGG No data
1019502212_1019502222 0 Left 1019502212 7:1369953-1369975 CCCCAAAAGGGGCCCTGCTGTGT No data
Right 1019502222 7:1369976-1369998 GGGATATGAGATGGCGGGCAAGG No data
1019502212_1019502221 -5 Left 1019502212 7:1369953-1369975 CCCCAAAAGGGGCCCTGCTGTGT No data
Right 1019502221 7:1369971-1369993 TGTGTGGGATATGAGATGGCGGG No data
1019502212_1019502227 18 Left 1019502212 7:1369953-1369975 CCCCAAAAGGGGCCCTGCTGTGT No data
Right 1019502227 7:1369994-1370016 CAAGGCGGGCAAGGGATTGCAGG No data
1019502212_1019502220 -6 Left 1019502212 7:1369953-1369975 CCCCAAAAGGGGCCCTGCTGTGT No data
Right 1019502220 7:1369970-1369992 CTGTGTGGGATATGAGATGGCGG No data
1019502212_1019502223 3 Left 1019502212 7:1369953-1369975 CCCCAAAAGGGGCCCTGCTGTGT No data
Right 1019502223 7:1369979-1370001 ATATGAGATGGCGGGCAAGGCGG No data
1019502212_1019502225 9 Left 1019502212 7:1369953-1369975 CCCCAAAAGGGGCCCTGCTGTGT No data
Right 1019502225 7:1369985-1370007 GATGGCGGGCAAGGCGGGCAAGG No data
1019502212_1019502226 10 Left 1019502212 7:1369953-1369975 CCCCAAAAGGGGCCCTGCTGTGT No data
Right 1019502226 7:1369986-1370008 ATGGCGGGCAAGGCGGGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019502212 Original CRISPR ACACAGCAGGGCCCCTTTTG GGG (reversed) Intergenic
No off target data available for this crispr