ID: 1019502213

View in Genome Browser
Species Human (GRCh38)
Location 7:1369954-1369976
Sequence CACACAGCAGGGCCCCTTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019502213_1019502221 -6 Left 1019502213 7:1369954-1369976 CCCAAAAGGGGCCCTGCTGTGTG No data
Right 1019502221 7:1369971-1369993 TGTGTGGGATATGAGATGGCGGG No data
1019502213_1019502224 3 Left 1019502213 7:1369954-1369976 CCCAAAAGGGGCCCTGCTGTGTG No data
Right 1019502224 7:1369980-1370002 TATGAGATGGCGGGCAAGGCGGG No data
1019502213_1019502225 8 Left 1019502213 7:1369954-1369976 CCCAAAAGGGGCCCTGCTGTGTG No data
Right 1019502225 7:1369985-1370007 GATGGCGGGCAAGGCGGGCAAGG No data
1019502213_1019502226 9 Left 1019502213 7:1369954-1369976 CCCAAAAGGGGCCCTGCTGTGTG No data
Right 1019502226 7:1369986-1370008 ATGGCGGGCAAGGCGGGCAAGGG No data
1019502213_1019502219 -10 Left 1019502213 7:1369954-1369976 CCCAAAAGGGGCCCTGCTGTGTG No data
Right 1019502219 7:1369967-1369989 CTGCTGTGTGGGATATGAGATGG No data
1019502213_1019502220 -7 Left 1019502213 7:1369954-1369976 CCCAAAAGGGGCCCTGCTGTGTG No data
Right 1019502220 7:1369970-1369992 CTGTGTGGGATATGAGATGGCGG No data
1019502213_1019502223 2 Left 1019502213 7:1369954-1369976 CCCAAAAGGGGCCCTGCTGTGTG No data
Right 1019502223 7:1369979-1370001 ATATGAGATGGCGGGCAAGGCGG No data
1019502213_1019502228 29 Left 1019502213 7:1369954-1369976 CCCAAAAGGGGCCCTGCTGTGTG No data
Right 1019502228 7:1370006-1370028 GGGATTGCAGGCACGTGCTGTGG No data
1019502213_1019502227 17 Left 1019502213 7:1369954-1369976 CCCAAAAGGGGCCCTGCTGTGTG No data
Right 1019502227 7:1369994-1370016 CAAGGCGGGCAAGGGATTGCAGG No data
1019502213_1019502222 -1 Left 1019502213 7:1369954-1369976 CCCAAAAGGGGCCCTGCTGTGTG No data
Right 1019502222 7:1369976-1369998 GGGATATGAGATGGCGGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019502213 Original CRISPR CACACAGCAGGGCCCCTTTT GGG (reversed) Intergenic