ID: 1019502218

View in Genome Browser
Species Human (GRCh38)
Location 7:1369966-1369988
Sequence CATCTCATATCCCACACAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019502218_1019502227 5 Left 1019502218 7:1369966-1369988 CCTGCTGTGTGGGATATGAGATG No data
Right 1019502227 7:1369994-1370016 CAAGGCGGGCAAGGGATTGCAGG No data
1019502218_1019502225 -4 Left 1019502218 7:1369966-1369988 CCTGCTGTGTGGGATATGAGATG No data
Right 1019502225 7:1369985-1370007 GATGGCGGGCAAGGCGGGCAAGG No data
1019502218_1019502223 -10 Left 1019502218 7:1369966-1369988 CCTGCTGTGTGGGATATGAGATG No data
Right 1019502223 7:1369979-1370001 ATATGAGATGGCGGGCAAGGCGG No data
1019502218_1019502230 26 Left 1019502218 7:1369966-1369988 CCTGCTGTGTGGGATATGAGATG No data
Right 1019502230 7:1370015-1370037 GGCACGTGCTGTGGTGTGGCTGG No data
1019502218_1019502226 -3 Left 1019502218 7:1369966-1369988 CCTGCTGTGTGGGATATGAGATG No data
Right 1019502226 7:1369986-1370008 ATGGCGGGCAAGGCGGGCAAGGG No data
1019502218_1019502224 -9 Left 1019502218 7:1369966-1369988 CCTGCTGTGTGGGATATGAGATG No data
Right 1019502224 7:1369980-1370002 TATGAGATGGCGGGCAAGGCGGG No data
1019502218_1019502229 22 Left 1019502218 7:1369966-1369988 CCTGCTGTGTGGGATATGAGATG No data
Right 1019502229 7:1370011-1370033 TGCAGGCACGTGCTGTGGTGTGG No data
1019502218_1019502228 17 Left 1019502218 7:1369966-1369988 CCTGCTGTGTGGGATATGAGATG No data
Right 1019502228 7:1370006-1370028 GGGATTGCAGGCACGTGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019502218 Original CRISPR CATCTCATATCCCACACAGC AGG (reversed) Intergenic
No off target data available for this crispr