ID: 1019502222

View in Genome Browser
Species Human (GRCh38)
Location 7:1369976-1369998
Sequence GGGATATGAGATGGCGGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019502213_1019502222 -1 Left 1019502213 7:1369954-1369976 CCCAAAAGGGGCCCTGCTGTGTG No data
Right 1019502222 7:1369976-1369998 GGGATATGAGATGGCGGGCAAGG No data
1019502214_1019502222 -2 Left 1019502214 7:1369955-1369977 CCAAAAGGGGCCCTGCTGTGTGG No data
Right 1019502222 7:1369976-1369998 GGGATATGAGATGGCGGGCAAGG No data
1019502205_1019502222 27 Left 1019502205 7:1369926-1369948 CCCAGGCAGCCTGTAATGGGATT No data
Right 1019502222 7:1369976-1369998 GGGATATGAGATGGCGGGCAAGG No data
1019502211_1019502222 1 Left 1019502211 7:1369952-1369974 CCCCCAAAAGGGGCCCTGCTGTG No data
Right 1019502222 7:1369976-1369998 GGGATATGAGATGGCGGGCAAGG No data
1019502204_1019502222 28 Left 1019502204 7:1369925-1369947 CCCCAGGCAGCCTGTAATGGGAT No data
Right 1019502222 7:1369976-1369998 GGGATATGAGATGGCGGGCAAGG No data
1019502206_1019502222 26 Left 1019502206 7:1369927-1369949 CCAGGCAGCCTGTAATGGGATTG No data
Right 1019502222 7:1369976-1369998 GGGATATGAGATGGCGGGCAAGG No data
1019502207_1019502222 18 Left 1019502207 7:1369935-1369957 CCTGTAATGGGATTGCTCCCCCA No data
Right 1019502222 7:1369976-1369998 GGGATATGAGATGGCGGGCAAGG No data
1019502212_1019502222 0 Left 1019502212 7:1369953-1369975 CCCCAAAAGGGGCCCTGCTGTGT No data
Right 1019502222 7:1369976-1369998 GGGATATGAGATGGCGGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019502222 Original CRISPR GGGATATGAGATGGCGGGCA AGG Intergenic
No off target data available for this crispr