ID: 1019502223

View in Genome Browser
Species Human (GRCh38)
Location 7:1369979-1370001
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019502211_1019502223 4 Left 1019502211 7:1369952-1369974 CCCCCAAAAGGGGCCCTGCTGTG No data
Right 1019502223 7:1369979-1370001 ATATGAGATGGCGGGCAAGGCGG No data
1019502217_1019502223 -9 Left 1019502217 7:1369965-1369987 CCCTGCTGTGTGGGATATGAGAT No data
Right 1019502223 7:1369979-1370001 ATATGAGATGGCGGGCAAGGCGG No data
1019502218_1019502223 -10 Left 1019502218 7:1369966-1369988 CCTGCTGTGTGGGATATGAGATG No data
Right 1019502223 7:1369979-1370001 ATATGAGATGGCGGGCAAGGCGG No data
1019502214_1019502223 1 Left 1019502214 7:1369955-1369977 CCAAAAGGGGCCCTGCTGTGTGG No data
Right 1019502223 7:1369979-1370001 ATATGAGATGGCGGGCAAGGCGG No data
1019502205_1019502223 30 Left 1019502205 7:1369926-1369948 CCCAGGCAGCCTGTAATGGGATT No data
Right 1019502223 7:1369979-1370001 ATATGAGATGGCGGGCAAGGCGG No data
1019502207_1019502223 21 Left 1019502207 7:1369935-1369957 CCTGTAATGGGATTGCTCCCCCA No data
Right 1019502223 7:1369979-1370001 ATATGAGATGGCGGGCAAGGCGG No data
1019502212_1019502223 3 Left 1019502212 7:1369953-1369975 CCCCAAAAGGGGCCCTGCTGTGT No data
Right 1019502223 7:1369979-1370001 ATATGAGATGGCGGGCAAGGCGG No data
1019502206_1019502223 29 Left 1019502206 7:1369927-1369949 CCAGGCAGCCTGTAATGGGATTG No data
Right 1019502223 7:1369979-1370001 ATATGAGATGGCGGGCAAGGCGG No data
1019502213_1019502223 2 Left 1019502213 7:1369954-1369976 CCCAAAAGGGGCCCTGCTGTGTG No data
Right 1019502223 7:1369979-1370001 ATATGAGATGGCGGGCAAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019502223 Original CRISPR ATATGAGATGGCGGGCAAGG CGG Intergenic