ID: 1019502224

View in Genome Browser
Species Human (GRCh38)
Location 7:1369980-1370002
Sequence TATGAGATGGCGGGCAAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019502217_1019502224 -8 Left 1019502217 7:1369965-1369987 CCCTGCTGTGTGGGATATGAGAT No data
Right 1019502224 7:1369980-1370002 TATGAGATGGCGGGCAAGGCGGG No data
1019502214_1019502224 2 Left 1019502214 7:1369955-1369977 CCAAAAGGGGCCCTGCTGTGTGG No data
Right 1019502224 7:1369980-1370002 TATGAGATGGCGGGCAAGGCGGG No data
1019502218_1019502224 -9 Left 1019502218 7:1369966-1369988 CCTGCTGTGTGGGATATGAGATG No data
Right 1019502224 7:1369980-1370002 TATGAGATGGCGGGCAAGGCGGG No data
1019502213_1019502224 3 Left 1019502213 7:1369954-1369976 CCCAAAAGGGGCCCTGCTGTGTG No data
Right 1019502224 7:1369980-1370002 TATGAGATGGCGGGCAAGGCGGG No data
1019502212_1019502224 4 Left 1019502212 7:1369953-1369975 CCCCAAAAGGGGCCCTGCTGTGT No data
Right 1019502224 7:1369980-1370002 TATGAGATGGCGGGCAAGGCGGG No data
1019502207_1019502224 22 Left 1019502207 7:1369935-1369957 CCTGTAATGGGATTGCTCCCCCA No data
Right 1019502224 7:1369980-1370002 TATGAGATGGCGGGCAAGGCGGG No data
1019502211_1019502224 5 Left 1019502211 7:1369952-1369974 CCCCCAAAAGGGGCCCTGCTGTG No data
Right 1019502224 7:1369980-1370002 TATGAGATGGCGGGCAAGGCGGG No data
1019502206_1019502224 30 Left 1019502206 7:1369927-1369949 CCAGGCAGCCTGTAATGGGATTG No data
Right 1019502224 7:1369980-1370002 TATGAGATGGCGGGCAAGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019502224 Original CRISPR TATGAGATGGCGGGCAAGGC GGG Intergenic
No off target data available for this crispr