ID: 1019502227

View in Genome Browser
Species Human (GRCh38)
Location 7:1369994-1370016
Sequence CAAGGCGGGCAAGGGATTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019502213_1019502227 17 Left 1019502213 7:1369954-1369976 CCCAAAAGGGGCCCTGCTGTGTG No data
Right 1019502227 7:1369994-1370016 CAAGGCGGGCAAGGGATTGCAGG No data
1019502214_1019502227 16 Left 1019502214 7:1369955-1369977 CCAAAAGGGGCCCTGCTGTGTGG No data
Right 1019502227 7:1369994-1370016 CAAGGCGGGCAAGGGATTGCAGG No data
1019502212_1019502227 18 Left 1019502212 7:1369953-1369975 CCCCAAAAGGGGCCCTGCTGTGT No data
Right 1019502227 7:1369994-1370016 CAAGGCGGGCAAGGGATTGCAGG No data
1019502211_1019502227 19 Left 1019502211 7:1369952-1369974 CCCCCAAAAGGGGCCCTGCTGTG No data
Right 1019502227 7:1369994-1370016 CAAGGCGGGCAAGGGATTGCAGG No data
1019502217_1019502227 6 Left 1019502217 7:1369965-1369987 CCCTGCTGTGTGGGATATGAGAT No data
Right 1019502227 7:1369994-1370016 CAAGGCGGGCAAGGGATTGCAGG No data
1019502218_1019502227 5 Left 1019502218 7:1369966-1369988 CCTGCTGTGTGGGATATGAGATG No data
Right 1019502227 7:1369994-1370016 CAAGGCGGGCAAGGGATTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019502227 Original CRISPR CAAGGCGGGCAAGGGATTGC AGG Intergenic
No off target data available for this crispr