ID: 1019502228

View in Genome Browser
Species Human (GRCh38)
Location 7:1370006-1370028
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019502218_1019502228 17 Left 1019502218 7:1369966-1369988 CCTGCTGTGTGGGATATGAGATG No data
Right 1019502228 7:1370006-1370028 GGGATTGCAGGCACGTGCTGTGG No data
1019502217_1019502228 18 Left 1019502217 7:1369965-1369987 CCCTGCTGTGTGGGATATGAGAT No data
Right 1019502228 7:1370006-1370028 GGGATTGCAGGCACGTGCTGTGG No data
1019502212_1019502228 30 Left 1019502212 7:1369953-1369975 CCCCAAAAGGGGCCCTGCTGTGT No data
Right 1019502228 7:1370006-1370028 GGGATTGCAGGCACGTGCTGTGG No data
1019502213_1019502228 29 Left 1019502213 7:1369954-1369976 CCCAAAAGGGGCCCTGCTGTGTG No data
Right 1019502228 7:1370006-1370028 GGGATTGCAGGCACGTGCTGTGG No data
1019502214_1019502228 28 Left 1019502214 7:1369955-1369977 CCAAAAGGGGCCCTGCTGTGTGG No data
Right 1019502228 7:1370006-1370028 GGGATTGCAGGCACGTGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019502228 Original CRISPR GGGATTGCAGGCACGTGCTG TGG Intergenic