ID: 1019503265

View in Genome Browser
Species Human (GRCh38)
Location 7:1376243-1376265
Sequence ACAGCTGATGGGCCGTAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019503261_1019503265 8 Left 1019503261 7:1376212-1376234 CCTCTGTTGGGGAAATGGCTACG No data
Right 1019503265 7:1376243-1376265 ACAGCTGATGGGCCGTAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019503265 Original CRISPR ACAGCTGATGGGCCGTAAGC TGG Intergenic
No off target data available for this crispr