ID: 1019503985

View in Genome Browser
Species Human (GRCh38)
Location 7:1381382-1381404
Sequence CTGCGGGCTGACCCCAGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019503985_1019503993 3 Left 1019503985 7:1381382-1381404 CCCAGCCTGGGGTCAGCCCGCAG No data
Right 1019503993 7:1381408-1381430 CGGTGTGATGGCACTAGTTGAGG No data
1019503985_1019503990 -9 Left 1019503985 7:1381382-1381404 CCCAGCCTGGGGTCAGCCCGCAG No data
Right 1019503990 7:1381396-1381418 AGCCCGCAGAGGCGGTGTGATGG No data
1019503985_1019503994 24 Left 1019503985 7:1381382-1381404 CCCAGCCTGGGGTCAGCCCGCAG No data
Right 1019503994 7:1381429-1381451 GGTATTAATGAGATGCCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019503985 Original CRISPR CTGCGGGCTGACCCCAGGCT GGG (reversed) Intergenic