ID: 1019503986

View in Genome Browser
Species Human (GRCh38)
Location 7:1381383-1381405
Sequence TCTGCGGGCTGACCCCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019503986_1019503990 -10 Left 1019503986 7:1381383-1381405 CCAGCCTGGGGTCAGCCCGCAGA No data
Right 1019503990 7:1381396-1381418 AGCCCGCAGAGGCGGTGTGATGG No data
1019503986_1019503994 23 Left 1019503986 7:1381383-1381405 CCAGCCTGGGGTCAGCCCGCAGA No data
Right 1019503994 7:1381429-1381451 GGTATTAATGAGATGCCTCTAGG No data
1019503986_1019503993 2 Left 1019503986 7:1381383-1381405 CCAGCCTGGGGTCAGCCCGCAGA No data
Right 1019503993 7:1381408-1381430 CGGTGTGATGGCACTAGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019503986 Original CRISPR TCTGCGGGCTGACCCCAGGC TGG (reversed) Intergenic