ID: 1019503988 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:1381387-1381409 |
Sequence | CGCCTCTGCGGGCTGACCCC AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1019503988_1019503994 | 19 | Left | 1019503988 | 7:1381387-1381409 | CCTGGGGTCAGCCCGCAGAGGCG | No data | ||
Right | 1019503994 | 7:1381429-1381451 | GGTATTAATGAGATGCCTCTAGG | No data | ||||
1019503988_1019503993 | -2 | Left | 1019503988 | 7:1381387-1381409 | CCTGGGGTCAGCCCGCAGAGGCG | No data | ||
Right | 1019503993 | 7:1381408-1381430 | CGGTGTGATGGCACTAGTTGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1019503988 | Original CRISPR | CGCCTCTGCGGGCTGACCCC AGG (reversed) | Intergenic | ||