ID: 1019503988

View in Genome Browser
Species Human (GRCh38)
Location 7:1381387-1381409
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019503988_1019503994 19 Left 1019503988 7:1381387-1381409 CCTGGGGTCAGCCCGCAGAGGCG No data
Right 1019503994 7:1381429-1381451 GGTATTAATGAGATGCCTCTAGG No data
1019503988_1019503993 -2 Left 1019503988 7:1381387-1381409 CCTGGGGTCAGCCCGCAGAGGCG No data
Right 1019503993 7:1381408-1381430 CGGTGTGATGGCACTAGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019503988 Original CRISPR CGCCTCTGCGGGCTGACCCC AGG (reversed) Intergenic