ID: 1019503990

View in Genome Browser
Species Human (GRCh38)
Location 7:1381396-1381418
Sequence AGCCCGCAGAGGCGGTGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019503982_1019503990 1 Left 1019503982 7:1381372-1381394 CCTCTTCCCTCCCAGCCTGGGGT No data
Right 1019503990 7:1381396-1381418 AGCCCGCAGAGGCGGTGTGATGG No data
1019503983_1019503990 -5 Left 1019503983 7:1381378-1381400 CCCTCCCAGCCTGGGGTCAGCCC No data
Right 1019503990 7:1381396-1381418 AGCCCGCAGAGGCGGTGTGATGG No data
1019503985_1019503990 -9 Left 1019503985 7:1381382-1381404 CCCAGCCTGGGGTCAGCCCGCAG No data
Right 1019503990 7:1381396-1381418 AGCCCGCAGAGGCGGTGTGATGG No data
1019503986_1019503990 -10 Left 1019503986 7:1381383-1381405 CCAGCCTGGGGTCAGCCCGCAGA No data
Right 1019503990 7:1381396-1381418 AGCCCGCAGAGGCGGTGTGATGG No data
1019503978_1019503990 4 Left 1019503978 7:1381369-1381391 CCGCCTCTTCCCTCCCAGCCTGG No data
Right 1019503990 7:1381396-1381418 AGCCCGCAGAGGCGGTGTGATGG No data
1019503984_1019503990 -6 Left 1019503984 7:1381379-1381401 CCTCCCAGCCTGGGGTCAGCCCG No data
Right 1019503990 7:1381396-1381418 AGCCCGCAGAGGCGGTGTGATGG No data
1019503977_1019503990 11 Left 1019503977 7:1381362-1381384 CCGGGGGCCGCCTCTTCCCTCCC No data
Right 1019503990 7:1381396-1381418 AGCCCGCAGAGGCGGTGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019503990 Original CRISPR AGCCCGCAGAGGCGGTGTGA TGG Intergenic