ID: 1019503992

View in Genome Browser
Species Human (GRCh38)
Location 7:1381399-1381421
Sequence GTGCCATCACACCGCCTCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019503992_1019503995 19 Left 1019503992 7:1381399-1381421 CCGCAGAGGCGGTGTGATGGCAC No data
Right 1019503995 7:1381441-1381463 ATGCCTCTAGGTGCAAATAATGG No data
1019503992_1019503997 28 Left 1019503992 7:1381399-1381421 CCGCAGAGGCGGTGTGATGGCAC No data
Right 1019503997 7:1381450-1381472 GGTGCAAATAATGGTTTAATAGG No data
1019503992_1019503994 7 Left 1019503992 7:1381399-1381421 CCGCAGAGGCGGTGTGATGGCAC No data
Right 1019503994 7:1381429-1381451 GGTATTAATGAGATGCCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019503992 Original CRISPR GTGCCATCACACCGCCTCTG CGG (reversed) Intergenic