ID: 1019503992 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:1381399-1381421 |
| Sequence | GTGCCATCACACCGCCTCTG CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1019503992_1019503995 | 19 | Left | 1019503992 | 7:1381399-1381421 | CCGCAGAGGCGGTGTGATGGCAC | No data | ||
| Right | 1019503995 | 7:1381441-1381463 | ATGCCTCTAGGTGCAAATAATGG | No data | ||||
| 1019503992_1019503997 | 28 | Left | 1019503992 | 7:1381399-1381421 | CCGCAGAGGCGGTGTGATGGCAC | No data | ||
| Right | 1019503997 | 7:1381450-1381472 | GGTGCAAATAATGGTTTAATAGG | No data | ||||
| 1019503992_1019503994 | 7 | Left | 1019503992 | 7:1381399-1381421 | CCGCAGAGGCGGTGTGATGGCAC | No data | ||
| Right | 1019503994 | 7:1381429-1381451 | GGTATTAATGAGATGCCTCTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1019503992 | Original CRISPR | GTGCCATCACACCGCCTCTG CGG (reversed) | Intergenic | ||