ID: 1019503994

View in Genome Browser
Species Human (GRCh38)
Location 7:1381429-1381451
Sequence GGTATTAATGAGATGCCTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019503985_1019503994 24 Left 1019503985 7:1381382-1381404 CCCAGCCTGGGGTCAGCCCGCAG No data
Right 1019503994 7:1381429-1381451 GGTATTAATGAGATGCCTCTAGG No data
1019503984_1019503994 27 Left 1019503984 7:1381379-1381401 CCTCCCAGCCTGGGGTCAGCCCG No data
Right 1019503994 7:1381429-1381451 GGTATTAATGAGATGCCTCTAGG No data
1019503992_1019503994 7 Left 1019503992 7:1381399-1381421 CCGCAGAGGCGGTGTGATGGCAC No data
Right 1019503994 7:1381429-1381451 GGTATTAATGAGATGCCTCTAGG No data
1019503983_1019503994 28 Left 1019503983 7:1381378-1381400 CCCTCCCAGCCTGGGGTCAGCCC No data
Right 1019503994 7:1381429-1381451 GGTATTAATGAGATGCCTCTAGG No data
1019503988_1019503994 19 Left 1019503988 7:1381387-1381409 CCTGGGGTCAGCCCGCAGAGGCG No data
Right 1019503994 7:1381429-1381451 GGTATTAATGAGATGCCTCTAGG No data
1019503986_1019503994 23 Left 1019503986 7:1381383-1381405 CCAGCCTGGGGTCAGCCCGCAGA No data
Right 1019503994 7:1381429-1381451 GGTATTAATGAGATGCCTCTAGG No data
1019503991_1019503994 8 Left 1019503991 7:1381398-1381420 CCCGCAGAGGCGGTGTGATGGCA No data
Right 1019503994 7:1381429-1381451 GGTATTAATGAGATGCCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019503994 Original CRISPR GGTATTAATGAGATGCCTCT AGG Intergenic