ID: 1019503995 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:1381441-1381463 |
Sequence | ATGCCTCTAGGTGCAAATAA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1019503992_1019503995 | 19 | Left | 1019503992 | 7:1381399-1381421 | CCGCAGAGGCGGTGTGATGGCAC | No data | ||
Right | 1019503995 | 7:1381441-1381463 | ATGCCTCTAGGTGCAAATAATGG | No data | ||||
1019503991_1019503995 | 20 | Left | 1019503991 | 7:1381398-1381420 | CCCGCAGAGGCGGTGTGATGGCA | No data | ||
Right | 1019503995 | 7:1381441-1381463 | ATGCCTCTAGGTGCAAATAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1019503995 | Original CRISPR | ATGCCTCTAGGTGCAAATAA TGG | Intergenic | ||