ID: 1019503997

View in Genome Browser
Species Human (GRCh38)
Location 7:1381450-1381472
Sequence GGTGCAAATAATGGTTTAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019503992_1019503997 28 Left 1019503992 7:1381399-1381421 CCGCAGAGGCGGTGTGATGGCAC No data
Right 1019503997 7:1381450-1381472 GGTGCAAATAATGGTTTAATAGG No data
1019503991_1019503997 29 Left 1019503991 7:1381398-1381420 CCCGCAGAGGCGGTGTGATGGCA No data
Right 1019503997 7:1381450-1381472 GGTGCAAATAATGGTTTAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019503997 Original CRISPR GGTGCAAATAATGGTTTAAT AGG Intergenic