ID: 1019504025

View in Genome Browser
Species Human (GRCh38)
Location 7:1381698-1381720
Sequence CACCCTTGGGGGGCTGGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019504025_1019504045 24 Left 1019504025 7:1381698-1381720 CCCCTCCCAGCCCCCCAAGGGTG No data
Right 1019504045 7:1381745-1381767 ACCTCTCGGAAGCCATGACTTGG No data
1019504025_1019504040 10 Left 1019504025 7:1381698-1381720 CCCCTCCCAGCCCCCCAAGGGTG No data
Right 1019504040 7:1381731-1381753 GGTGCCCCCTTCTCACCTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019504025 Original CRISPR CACCCTTGGGGGGCTGGGAG GGG (reversed) Intergenic
No off target data available for this crispr