ID: 1019504221

View in Genome Browser
Species Human (GRCh38)
Location 7:1382783-1382805
Sequence CGTCCGGGAGGTGAGCCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019504221_1019504231 -4 Left 1019504221 7:1382783-1382805 CCCAGGGGCTCACCTCCCGGACG No data
Right 1019504231 7:1382802-1382824 GACGAGGGGCAGGTGTAATTGGG No data
1019504221_1019504230 -5 Left 1019504221 7:1382783-1382805 CCCAGGGGCTCACCTCCCGGACG No data
Right 1019504230 7:1382801-1382823 GGACGAGGGGCAGGTGTAATTGG No data
1019504221_1019504233 0 Left 1019504221 7:1382783-1382805 CCCAGGGGCTCACCTCCCGGACG No data
Right 1019504233 7:1382806-1382828 AGGGGCAGGTGTAATTGGGGTGG No data
1019504221_1019504235 14 Left 1019504221 7:1382783-1382805 CCCAGGGGCTCACCTCCCGGACG No data
Right 1019504235 7:1382820-1382842 TTGGGGTGGGAGAGACCCCAAGG No data
1019504221_1019504232 -3 Left 1019504221 7:1382783-1382805 CCCAGGGGCTCACCTCCCGGACG No data
Right 1019504232 7:1382803-1382825 ACGAGGGGCAGGTGTAATTGGGG No data
1019504221_1019504234 1 Left 1019504221 7:1382783-1382805 CCCAGGGGCTCACCTCCCGGACG No data
Right 1019504234 7:1382807-1382829 GGGGCAGGTGTAATTGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019504221 Original CRISPR CGTCCGGGAGGTGAGCCCCT GGG (reversed) Intergenic
No off target data available for this crispr