ID: 1019504701

View in Genome Browser
Species Human (GRCh38)
Location 7:1385175-1385197
Sequence GATGGGACCCAGGGAGCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019504701_1019504719 27 Left 1019504701 7:1385175-1385197 CCACCAGCTCCCTGGGTCCCATC No data
Right 1019504719 7:1385225-1385247 ACAGGTGTGGCTACAGCAGGTGG No data
1019504701_1019504721 29 Left 1019504701 7:1385175-1385197 CCACCAGCTCCCTGGGTCCCATC No data
Right 1019504721 7:1385227-1385249 AGGTGTGGCTACAGCAGGTGGGG No data
1019504701_1019504715 14 Left 1019504701 7:1385175-1385197 CCACCAGCTCCCTGGGTCCCATC No data
Right 1019504715 7:1385212-1385234 CCCACTCCTGGACACAGGTGTGG No data
1019504701_1019504713 9 Left 1019504701 7:1385175-1385197 CCACCAGCTCCCTGGGTCCCATC No data
Right 1019504713 7:1385207-1385229 GTGAGCCCACTCCTGGACACAGG No data
1019504701_1019504720 28 Left 1019504701 7:1385175-1385197 CCACCAGCTCCCTGGGTCCCATC No data
Right 1019504720 7:1385226-1385248 CAGGTGTGGCTACAGCAGGTGGG No data
1019504701_1019504718 24 Left 1019504701 7:1385175-1385197 CCACCAGCTCCCTGGGTCCCATC No data
Right 1019504718 7:1385222-1385244 GACACAGGTGTGGCTACAGCAGG No data
1019504701_1019504710 2 Left 1019504701 7:1385175-1385197 CCACCAGCTCCCTGGGTCCCATC No data
Right 1019504710 7:1385200-1385222 CTGACCCGTGAGCCCACTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019504701 Original CRISPR GATGGGACCCAGGGAGCTGG TGG (reversed) Intergenic
No off target data available for this crispr