ID: 1019504703

View in Genome Browser
Species Human (GRCh38)
Location 7:1385184-1385206
Sequence GGGTCAGGGGATGGGACCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019504703_1019504719 18 Left 1019504703 7:1385184-1385206 CCCTGGGTCCCATCCCCTGACCC No data
Right 1019504719 7:1385225-1385247 ACAGGTGTGGCTACAGCAGGTGG No data
1019504703_1019504720 19 Left 1019504703 7:1385184-1385206 CCCTGGGTCCCATCCCCTGACCC No data
Right 1019504720 7:1385226-1385248 CAGGTGTGGCTACAGCAGGTGGG No data
1019504703_1019504718 15 Left 1019504703 7:1385184-1385206 CCCTGGGTCCCATCCCCTGACCC No data
Right 1019504718 7:1385222-1385244 GACACAGGTGTGGCTACAGCAGG No data
1019504703_1019504721 20 Left 1019504703 7:1385184-1385206 CCCTGGGTCCCATCCCCTGACCC No data
Right 1019504721 7:1385227-1385249 AGGTGTGGCTACAGCAGGTGGGG No data
1019504703_1019504723 28 Left 1019504703 7:1385184-1385206 CCCTGGGTCCCATCCCCTGACCC No data
Right 1019504723 7:1385235-1385257 CTACAGCAGGTGGGGCAGGCCGG No data
1019504703_1019504722 24 Left 1019504703 7:1385184-1385206 CCCTGGGTCCCATCCCCTGACCC No data
Right 1019504722 7:1385231-1385253 GTGGCTACAGCAGGTGGGGCAGG No data
1019504703_1019504725 30 Left 1019504703 7:1385184-1385206 CCCTGGGTCCCATCCCCTGACCC No data
Right 1019504725 7:1385237-1385259 ACAGCAGGTGGGGCAGGCCGGGG No data
1019504703_1019504713 0 Left 1019504703 7:1385184-1385206 CCCTGGGTCCCATCCCCTGACCC No data
Right 1019504713 7:1385207-1385229 GTGAGCCCACTCCTGGACACAGG No data
1019504703_1019504715 5 Left 1019504703 7:1385184-1385206 CCCTGGGTCCCATCCCCTGACCC No data
Right 1019504715 7:1385212-1385234 CCCACTCCTGGACACAGGTGTGG No data
1019504703_1019504724 29 Left 1019504703 7:1385184-1385206 CCCTGGGTCCCATCCCCTGACCC No data
Right 1019504724 7:1385236-1385258 TACAGCAGGTGGGGCAGGCCGGG No data
1019504703_1019504710 -7 Left 1019504703 7:1385184-1385206 CCCTGGGTCCCATCCCCTGACCC No data
Right 1019504710 7:1385200-1385222 CTGACCCGTGAGCCCACTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019504703 Original CRISPR GGGTCAGGGGATGGGACCCA GGG (reversed) Intergenic
No off target data available for this crispr