ID: 1019504712

View in Genome Browser
Species Human (GRCh38)
Location 7:1385205-1385227
Sequence TGTGTCCAGGAGTGGGCTCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 17 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019504712_1019504726 13 Left 1019504712 7:1385205-1385227 CCGTGAGCCCACTCCTGGACACA No data
Right 1019504726 7:1385241-1385263 CAGGTGGGGCAGGCCGGGGCAGG No data
1019504712_1019504730 23 Left 1019504712 7:1385205-1385227 CCGTGAGCCCACTCCTGGACACA No data
Right 1019504730 7:1385251-1385273 AGGCCGGGGCAGGGCAGGCCGGG No data
1019504712_1019504733 27 Left 1019504712 7:1385205-1385227 CCGTGAGCCCACTCCTGGACACA No data
Right 1019504733 7:1385255-1385277 CGGGGCAGGGCAGGCCGGGGCGG No data
1019504712_1019504721 -1 Left 1019504712 7:1385205-1385227 CCGTGAGCCCACTCCTGGACACA No data
Right 1019504721 7:1385227-1385249 AGGTGTGGCTACAGCAGGTGGGG No data
1019504712_1019504725 9 Left 1019504712 7:1385205-1385227 CCGTGAGCCCACTCCTGGACACA No data
Right 1019504725 7:1385237-1385259 ACAGCAGGTGGGGCAGGCCGGGG No data
1019504712_1019504735 29 Left 1019504712 7:1385205-1385227 CCGTGAGCCCACTCCTGGACACA No data
Right 1019504735 7:1385257-1385279 GGGCAGGGCAGGCCGGGGCGGGG No data
1019504712_1019504723 7 Left 1019504712 7:1385205-1385227 CCGTGAGCCCACTCCTGGACACA No data
Right 1019504723 7:1385235-1385257 CTACAGCAGGTGGGGCAGGCCGG No data
1019504712_1019504718 -6 Left 1019504712 7:1385205-1385227 CCGTGAGCCCACTCCTGGACACA No data
Right 1019504718 7:1385222-1385244 GACACAGGTGTGGCTACAGCAGG No data
1019504712_1019504727 14 Left 1019504712 7:1385205-1385227 CCGTGAGCCCACTCCTGGACACA No data
Right 1019504727 7:1385242-1385264 AGGTGGGGCAGGCCGGGGCAGGG No data
1019504712_1019504724 8 Left 1019504712 7:1385205-1385227 CCGTGAGCCCACTCCTGGACACA No data
Right 1019504724 7:1385236-1385258 TACAGCAGGTGGGGCAGGCCGGG No data
1019504712_1019504731 24 Left 1019504712 7:1385205-1385227 CCGTGAGCCCACTCCTGGACACA No data
Right 1019504731 7:1385252-1385274 GGCCGGGGCAGGGCAGGCCGGGG No data
1019504712_1019504722 3 Left 1019504712 7:1385205-1385227 CCGTGAGCCCACTCCTGGACACA No data
Right 1019504722 7:1385231-1385253 GTGGCTACAGCAGGTGGGGCAGG No data
1019504712_1019504734 28 Left 1019504712 7:1385205-1385227 CCGTGAGCCCACTCCTGGACACA No data
Right 1019504734 7:1385256-1385278 GGGGCAGGGCAGGCCGGGGCGGG No data
1019504712_1019504728 18 Left 1019504712 7:1385205-1385227 CCGTGAGCCCACTCCTGGACACA No data
Right 1019504728 7:1385246-1385268 GGGGCAGGCCGGGGCAGGGCAGG No data
1019504712_1019504719 -3 Left 1019504712 7:1385205-1385227 CCGTGAGCCCACTCCTGGACACA No data
Right 1019504719 7:1385225-1385247 ACAGGTGTGGCTACAGCAGGTGG No data
1019504712_1019504729 22 Left 1019504712 7:1385205-1385227 CCGTGAGCCCACTCCTGGACACA No data
Right 1019504729 7:1385250-1385272 CAGGCCGGGGCAGGGCAGGCCGG No data
1019504712_1019504720 -2 Left 1019504712 7:1385205-1385227 CCGTGAGCCCACTCCTGGACACA No data
Right 1019504720 7:1385226-1385248 CAGGTGTGGCTACAGCAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019504712 Original CRISPR TGTGTCCAGGAGTGGGCTCA CGG (reversed) Intergenic
No off target data available for this crispr