ID: 1019504718

View in Genome Browser
Species Human (GRCh38)
Location 7:1385222-1385244
Sequence GACACAGGTGTGGCTACAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019504707_1019504718 2 Left 1019504707 7:1385197-1385219 CCCCTGACCCGTGAGCCCACTCC No data
Right 1019504718 7:1385222-1385244 GACACAGGTGTGGCTACAGCAGG No data
1019504701_1019504718 24 Left 1019504701 7:1385175-1385197 CCACCAGCTCCCTGGGTCCCATC No data
Right 1019504718 7:1385222-1385244 GACACAGGTGTGGCTACAGCAGG No data
1019504704_1019504718 14 Left 1019504704 7:1385185-1385207 CCTGGGTCCCATCCCCTGACCCG No data
Right 1019504718 7:1385222-1385244 GACACAGGTGTGGCTACAGCAGG No data
1019504708_1019504718 1 Left 1019504708 7:1385198-1385220 CCCTGACCCGTGAGCCCACTCCT No data
Right 1019504718 7:1385222-1385244 GACACAGGTGTGGCTACAGCAGG No data
1019504712_1019504718 -6 Left 1019504712 7:1385205-1385227 CCGTGAGCCCACTCCTGGACACA No data
Right 1019504718 7:1385222-1385244 GACACAGGTGTGGCTACAGCAGG No data
1019504705_1019504718 7 Left 1019504705 7:1385192-1385214 CCCATCCCCTGACCCGTGAGCCC No data
Right 1019504718 7:1385222-1385244 GACACAGGTGTGGCTACAGCAGG No data
1019504711_1019504718 -5 Left 1019504711 7:1385204-1385226 CCCGTGAGCCCACTCCTGGACAC No data
Right 1019504718 7:1385222-1385244 GACACAGGTGTGGCTACAGCAGG No data
1019504706_1019504718 6 Left 1019504706 7:1385193-1385215 CCATCCCCTGACCCGTGAGCCCA No data
Right 1019504718 7:1385222-1385244 GACACAGGTGTGGCTACAGCAGG No data
1019504702_1019504718 21 Left 1019504702 7:1385178-1385200 CCAGCTCCCTGGGTCCCATCCCC No data
Right 1019504718 7:1385222-1385244 GACACAGGTGTGGCTACAGCAGG No data
1019504703_1019504718 15 Left 1019504703 7:1385184-1385206 CCCTGGGTCCCATCCCCTGACCC No data
Right 1019504718 7:1385222-1385244 GACACAGGTGTGGCTACAGCAGG No data
1019504709_1019504718 0 Left 1019504709 7:1385199-1385221 CCTGACCCGTGAGCCCACTCCTG No data
Right 1019504718 7:1385222-1385244 GACACAGGTGTGGCTACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019504718 Original CRISPR GACACAGGTGTGGCTACAGC AGG Intergenic
No off target data available for this crispr