ID: 1019506000

View in Genome Browser
Species Human (GRCh38)
Location 7:1391725-1391747
Sequence CCTCATGAGAGCCTGGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019506000_1019506005 -10 Left 1019506000 7:1391725-1391747 CCTGGCTCCAGGCTCTCATGAGG No data
Right 1019506005 7:1391738-1391760 TCTCATGAGGCTGCAGTCAGGGG No data
1019506000_1019506006 -2 Left 1019506000 7:1391725-1391747 CCTGGCTCCAGGCTCTCATGAGG No data
Right 1019506006 7:1391746-1391768 GGCTGCAGTCAGGGGTCAGCTGG No data
1019506000_1019506010 25 Left 1019506000 7:1391725-1391747 CCTGGCTCCAGGCTCTCATGAGG No data
Right 1019506010 7:1391773-1391795 GTGTCATCTGAAGGCTCAACTGG No data
1019506000_1019506007 -1 Left 1019506000 7:1391725-1391747 CCTGGCTCCAGGCTCTCATGAGG No data
Right 1019506007 7:1391747-1391769 GCTGCAGTCAGGGGTCAGCTGGG No data
1019506000_1019506012 27 Left 1019506000 7:1391725-1391747 CCTGGCTCCAGGCTCTCATGAGG No data
Right 1019506012 7:1391775-1391797 GTCATCTGAAGGCTCAACTGGGG 0: 12
1: 59
2: 262
3: 539
4: 863
1019506000_1019506011 26 Left 1019506000 7:1391725-1391747 CCTGGCTCCAGGCTCTCATGAGG No data
Right 1019506011 7:1391774-1391796 TGTCATCTGAAGGCTCAACTGGG No data
1019506000_1019506008 0 Left 1019506000 7:1391725-1391747 CCTGGCTCCAGGCTCTCATGAGG No data
Right 1019506008 7:1391748-1391770 CTGCAGTCAGGGGTCAGCTGGGG No data
1019506000_1019506009 16 Left 1019506000 7:1391725-1391747 CCTGGCTCCAGGCTCTCATGAGG No data
Right 1019506009 7:1391764-1391786 GCTGGGGCTGTGTCATCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019506000 Original CRISPR CCTCATGAGAGCCTGGAGCC AGG (reversed) Intergenic
No off target data available for this crispr