ID: 1019508252

View in Genome Browser
Species Human (GRCh38)
Location 7:1404410-1404432
Sequence AAACAGGAGCGTGCGCGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019508242_1019508252 27 Left 1019508242 7:1404360-1404382 CCATCCCCCAAAGCTAATCAAGA No data
Right 1019508252 7:1404410-1404432 AAACAGGAGCGTGCGCGCGCGGG No data
1019508243_1019508252 23 Left 1019508243 7:1404364-1404386 CCCCCAAAGCTAATCAAGAACCC No data
Right 1019508252 7:1404410-1404432 AAACAGGAGCGTGCGCGCGCGGG No data
1019508249_1019508252 2 Left 1019508249 7:1404385-1404407 CCGGCGCAATTAACTGCTTAATT No data
Right 1019508252 7:1404410-1404432 AAACAGGAGCGTGCGCGCGCGGG No data
1019508244_1019508252 22 Left 1019508244 7:1404365-1404387 CCCCAAAGCTAATCAAGAACCCG No data
Right 1019508252 7:1404410-1404432 AAACAGGAGCGTGCGCGCGCGGG No data
1019508248_1019508252 3 Left 1019508248 7:1404384-1404406 CCCGGCGCAATTAACTGCTTAAT No data
Right 1019508252 7:1404410-1404432 AAACAGGAGCGTGCGCGCGCGGG No data
1019508247_1019508252 20 Left 1019508247 7:1404367-1404389 CCAAAGCTAATCAAGAACCCGGC No data
Right 1019508252 7:1404410-1404432 AAACAGGAGCGTGCGCGCGCGGG No data
1019508245_1019508252 21 Left 1019508245 7:1404366-1404388 CCCAAAGCTAATCAAGAACCCGG No data
Right 1019508252 7:1404410-1404432 AAACAGGAGCGTGCGCGCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019508252 Original CRISPR AAACAGGAGCGTGCGCGCGC GGG Intergenic
No off target data available for this crispr