ID: 1019508915

View in Genome Browser
Species Human (GRCh38)
Location 7:1407511-1407533
Sequence TTAAATACACAGATTTAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019508915_1019508921 8 Left 1019508915 7:1407511-1407533 CCTGGCTAAATCTGTGTATTTAA No data
Right 1019508921 7:1407542-1407564 ATCCTCAGGGTTTCCGGGCCAGG No data
1019508915_1019508924 10 Left 1019508915 7:1407511-1407533 CCTGGCTAAATCTGTGTATTTAA No data
Right 1019508924 7:1407544-1407566 CCTCAGGGTTTCCGGGCCAGGGG No data
1019508915_1019508920 3 Left 1019508915 7:1407511-1407533 CCTGGCTAAATCTGTGTATTTAA No data
Right 1019508920 7:1407537-1407559 AAGAAATCCTCAGGGTTTCCGGG No data
1019508915_1019508927 29 Left 1019508915 7:1407511-1407533 CCTGGCTAAATCTGTGTATTTAA No data
Right 1019508927 7:1407563-1407585 GGGGAGACCTGCTGCCACCCAGG No data
1019508915_1019508919 2 Left 1019508915 7:1407511-1407533 CCTGGCTAAATCTGTGTATTTAA No data
Right 1019508919 7:1407536-1407558 AAAGAAATCCTCAGGGTTTCCGG No data
1019508915_1019508917 -6 Left 1019508915 7:1407511-1407533 CCTGGCTAAATCTGTGTATTTAA No data
Right 1019508917 7:1407528-1407550 ATTTAAGGAAAGAAATCCTCAGG No data
1019508915_1019508918 -5 Left 1019508915 7:1407511-1407533 CCTGGCTAAATCTGTGTATTTAA No data
Right 1019508918 7:1407529-1407551 TTTAAGGAAAGAAATCCTCAGGG No data
1019508915_1019508922 9 Left 1019508915 7:1407511-1407533 CCTGGCTAAATCTGTGTATTTAA No data
Right 1019508922 7:1407543-1407565 TCCTCAGGGTTTCCGGGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019508915 Original CRISPR TTAAATACACAGATTTAGCC AGG (reversed) Intergenic
No off target data available for this crispr