ID: 1019509572

View in Genome Browser
Species Human (GRCh38)
Location 7:1411057-1411079
Sequence CTCCTAGAGCAGATGGAGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019509565_1019509572 -3 Left 1019509565 7:1411037-1411059 CCCAGTCCACCCTGAGTGACCTC No data
Right 1019509572 7:1411057-1411079 CTCCTAGAGCAGATGGAGCTCGG No data
1019509564_1019509572 20 Left 1019509564 7:1411014-1411036 CCATTGTGGGGAGCACAGAGCGT No data
Right 1019509572 7:1411057-1411079 CTCCTAGAGCAGATGGAGCTCGG No data
1019509562_1019509572 22 Left 1019509562 7:1411012-1411034 CCCCATTGTGGGGAGCACAGAGC No data
Right 1019509572 7:1411057-1411079 CTCCTAGAGCAGATGGAGCTCGG No data
1019509563_1019509572 21 Left 1019509563 7:1411013-1411035 CCCATTGTGGGGAGCACAGAGCG No data
Right 1019509572 7:1411057-1411079 CTCCTAGAGCAGATGGAGCTCGG No data
1019509566_1019509572 -4 Left 1019509566 7:1411038-1411060 CCAGTCCACCCTGAGTGACCTCC No data
Right 1019509572 7:1411057-1411079 CTCCTAGAGCAGATGGAGCTCGG No data
1019509567_1019509572 -9 Left 1019509567 7:1411043-1411065 CCACCCTGAGTGACCTCCTAGAG No data
Right 1019509572 7:1411057-1411079 CTCCTAGAGCAGATGGAGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019509572 Original CRISPR CTCCTAGAGCAGATGGAGCT CGG Intergenic
No off target data available for this crispr