ID: 1019513723

View in Genome Browser
Species Human (GRCh38)
Location 7:1430553-1430575
Sequence GAAACCAGTCAGGCTCAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019513710_1019513723 19 Left 1019513710 7:1430511-1430533 CCCCGGGCAGGGCAGGGGCAGCC 0: 1
1: 0
2: 4
3: 90
4: 638
Right 1019513723 7:1430553-1430575 GAAACCAGTCAGGCTCAAGCAGG No data
1019513709_1019513723 22 Left 1019513709 7:1430508-1430530 CCACCCCGGGCAGGGCAGGGGCA 0: 1
1: 0
2: 5
3: 45
4: 434
Right 1019513723 7:1430553-1430575 GAAACCAGTCAGGCTCAAGCAGG No data
1019513712_1019513723 17 Left 1019513712 7:1430513-1430535 CCGGGCAGGGCAGGGGCAGCCCC 0: 1
1: 1
2: 13
3: 116
4: 795
Right 1019513723 7:1430553-1430575 GAAACCAGTCAGGCTCAAGCAGG No data
1019513717_1019513723 -2 Left 1019513717 7:1430532-1430554 CCCCGGGGGTCCCACAAGTACGA 0: 1
1: 0
2: 0
3: 1
4: 14
Right 1019513723 7:1430553-1430575 GAAACCAGTCAGGCTCAAGCAGG No data
1019513704_1019513723 26 Left 1019513704 7:1430504-1430526 CCTCCCACCCCGGGCAGGGCAGG 0: 1
1: 2
2: 16
3: 65
4: 647
Right 1019513723 7:1430553-1430575 GAAACCAGTCAGGCTCAAGCAGG No data
1019513708_1019513723 23 Left 1019513708 7:1430507-1430529 CCCACCCCGGGCAGGGCAGGGGC 0: 1
1: 0
2: 7
3: 59
4: 521
Right 1019513723 7:1430553-1430575 GAAACCAGTCAGGCTCAAGCAGG No data
1019513719_1019513723 -4 Left 1019513719 7:1430534-1430556 CCGGGGGTCCCACAAGTACGAAA 0: 1
1: 0
2: 0
3: 5
4: 72
Right 1019513723 7:1430553-1430575 GAAACCAGTCAGGCTCAAGCAGG No data
1019513718_1019513723 -3 Left 1019513718 7:1430533-1430555 CCCGGGGGTCCCACAAGTACGAA 0: 1
1: 0
2: 0
3: 1
4: 36
Right 1019513723 7:1430553-1430575 GAAACCAGTCAGGCTCAAGCAGG No data
1019513711_1019513723 18 Left 1019513711 7:1430512-1430534 CCCGGGCAGGGCAGGGGCAGCCC 0: 1
1: 2
2: 27
3: 201
4: 1026
Right 1019513723 7:1430553-1430575 GAAACCAGTCAGGCTCAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019513723 Original CRISPR GAAACCAGTCAGGCTCAAGC AGG Intronic
No off target data available for this crispr