ID: 1019515285

View in Genome Browser
Species Human (GRCh38)
Location 7:1437272-1437294
Sequence CTCACAACAGCTGCGTGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 1, 2: 5, 3: 45, 4: 293}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019515280_1019515285 27 Left 1019515280 7:1437222-1437244 CCCTGACTGCTGCTACACTAAAT 0: 1
1: 0
2: 0
3: 6
4: 111
Right 1019515285 7:1437272-1437294 CTCACAACAGCTGCGTGAGGTGG 0: 1
1: 1
2: 5
3: 45
4: 293
1019515282_1019515285 3 Left 1019515282 7:1437246-1437268 CCTTGTGCGAATTGATTCGTTTA 0: 1
1: 0
2: 0
3: 2
4: 67
Right 1019515285 7:1437272-1437294 CTCACAACAGCTGCGTGAGGTGG 0: 1
1: 1
2: 5
3: 45
4: 293
1019515281_1019515285 26 Left 1019515281 7:1437223-1437245 CCTGACTGCTGCTACACTAAATG 0: 1
1: 0
2: 0
3: 6
4: 106
Right 1019515285 7:1437272-1437294 CTCACAACAGCTGCGTGAGGTGG 0: 1
1: 1
2: 5
3: 45
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019515285 Original CRISPR CTCACAACAGCTGCGTGAGG TGG Intronic
900385053 1:2406707-2406729 CTCACCGCAGGTGCGTGCGGGGG - Exonic
900677238 1:3895306-3895328 CCCCCAACAACTGCCTGAGGTGG + Intronic
901553313 1:10012502-10012524 TGCACAACAGCTGGGTGTGGTGG + Intronic
901575917 1:10200698-10200720 CTCACAACATGAGGGTGAGGTGG + Intergenic
901870739 1:12137932-12137954 CTCACAACCACTGTATGAGGTGG - Intronic
902835744 1:19045659-19045681 CTCACGACAGTGACGTGAGGTGG + Intergenic
902889609 1:19432640-19432662 CTCACAACAGCTGCAGGAGGTGG + Intronic
903796099 1:25929930-25929952 CTCACACCAGCTGGGTGCAGTGG + Intergenic
903931270 1:26863863-26863885 CTCGCAGCAGCTGCATGATGAGG - Exonic
904294072 1:29506419-29506441 CTCAAAACAGCTCCATGAGATGG - Intergenic
904625265 1:31798746-31798768 CTCACCCCAACTCCGTGAGGAGG + Intronic
905090657 1:35428996-35429018 CTCACAACAAATCCATGAGGTGG - Intergenic
907445096 1:54502437-54502459 CTTACCACAGCCCCGTGAGGTGG + Intergenic
908070249 1:60452682-60452704 CTCACAACAGCTTTATGAGTTGG + Intergenic
908203270 1:61819584-61819606 CTCTCAAAAGCAGCGTGGGGCGG + Intronic
908752914 1:67441864-67441886 CTCACCACAACTCTGTGAGGTGG - Intergenic
909105893 1:71407798-71407820 CTCACCACAGCCCTGTGAGGTGG - Intronic
912393015 1:109317844-109317866 CTAACAACAAATGGGTGAGGTGG - Exonic
912701297 1:111880339-111880361 CTGACAACTGCTGCTGGAGGAGG + Intronic
912746231 1:112247851-112247873 CTCACAACAGCTTTATGAGGAGG + Intergenic
913319051 1:117576006-117576028 CTCAGACCAGCTGGGTGACGAGG - Intergenic
914779984 1:150776667-150776689 CTCACTCCAGCTGGGTGTGGTGG + Intergenic
914988771 1:152480698-152480720 CCCACAACAGCCGAGTGAGGGGG + Intergenic
915361325 1:155287966-155287988 GTCACAGCAGCTGCCTGAAGGGG - Exonic
915520365 1:156438946-156438968 CTCACAACAACTGAATGAGAAGG - Intergenic
916206887 1:162323525-162323547 CTCACAACAACTGTATGAAGTGG - Intronic
917597991 1:176548940-176548962 CTCACAACAGTCCTGTGAGGTGG - Intronic
920311308 1:205050097-205050119 CTCTGAACAGCTTCGTGAGCTGG - Intronic
923772028 1:236945988-236946010 CTCTCAACAACTACATGAGGAGG + Intergenic
924756842 1:246948901-246948923 CTCAGAACAGCTCTGTGAGGTGG - Intronic
1062861113 10:810494-810516 AGCTCAACAGCTGCATGAGGAGG - Exonic
1063440057 10:6065566-6065588 CCCACAACCGCTGGGTGTGGTGG - Intergenic
1067031753 10:42882784-42882806 CTCAGGGCAGCTGAGTGAGGAGG + Intergenic
1067462380 10:46467198-46467220 ATCACAACAGCTCTGAGAGGTGG + Intergenic
1067624817 10:47917439-47917461 ATCACAACAGCTCTGAGAGGTGG - Intergenic
1069904477 10:71724264-71724286 TTCACACCAGGTGGGTGAGGGGG + Intronic
1070790814 10:79188315-79188337 GTCACATGAGCTGCCTGAGGCGG - Intronic
1072781571 10:98255378-98255400 CTCACAATAACTCCGTGAGGGGG + Intronic
1072948133 10:99829052-99829074 ATCACAGCAGCTGCCTGAGGTGG - Intronic
1074419154 10:113293871-113293893 CTCACAACTGCTCTGTAAGGTGG - Intergenic
1074753496 10:116608588-116608610 CTCACCACACATGTGTGAGGGGG - Intronic
1075464312 10:122640073-122640095 CTCACAGCAGCTGTCTCAGGTGG + Exonic
1075465335 10:122646704-122646726 CTCACCACAGCTGCCGGTGGTGG - Intergenic
1075907884 10:126098068-126098090 GTCCCAACAGCTGCATGACGAGG + Intronic
1076679577 10:132164845-132164867 CTCCCAACAGCAGCGGGAAGCGG + Intronic
1078129399 11:8600905-8600927 CTCACAATAACTCCGTGAGGTGG + Intergenic
1078665664 11:13323082-13323104 CTCACAACGGCTGGGTGCAGTGG - Intronic
1079134241 11:17767436-17767458 CTCACACCAGCTTGGTGAGACGG - Intronic
1082021685 11:47539362-47539384 TTCCCAACAGCTGGGTGTGGTGG + Intronic
1082064888 11:47892010-47892032 CTCACAACAGCCCTGAGAGGTGG - Intergenic
1082095797 11:48128196-48128218 CTCACAACAGCCCTGTGATGTGG + Intronic
1083504858 11:63146922-63146944 CTCACAACAACCCCGTGAGATGG + Intronic
1083713176 11:64560990-64561012 CTCACGACAACTGCGTGGGCAGG - Intronic
1084167851 11:67384708-67384730 CTCACAACAGCCCTTTGAGGTGG + Intronic
1084293683 11:68195381-68195403 CTCACAACAGCCCTGTGAGGTGG - Intronic
1084519471 11:69654758-69654780 CTCAGCACAGGTGTGTGAGGTGG + Intronic
1084639573 11:70416818-70416840 TTCACAACAGGTGCATGGGGGGG - Intronic
1085121690 11:73971455-73971477 CTCACAACATGCCCGTGAGGGGG - Intergenic
1086455735 11:86956640-86956662 CTTAGAACAACTGTGTGAGGTGG - Intergenic
1087805756 11:102553375-102553397 TTCACAACAGTTCAGTGAGGTGG - Intergenic
1089313253 11:117573904-117573926 CTCACAGCAGCAGAGGGAGGAGG - Intronic
1091786421 12:3245709-3245731 CTCACAGCACCTGGGTGTGGTGG + Intronic
1092586962 12:9909848-9909870 GTGGCAACAGCTGCTTGAGGGGG + Intronic
1093641594 12:21533525-21533547 CTCACAACAACTGTGTGAAATGG + Intronic
1094139376 12:27164841-27164863 CTCACAACAGCTGCTTTATTTGG - Intergenic
1096477742 12:51918714-51918736 CTCACAACAGCCCTGTGGGGTGG - Intronic
1096982210 12:55734815-55734837 CTCACAACTGCCCTGTGAGGTGG - Intergenic
1100331349 12:93585331-93585353 CTCAGACCAGCTGTTTGAGGAGG - Intergenic
1100891699 12:99132787-99132809 CTCACAACAACTTTTTGAGGTGG - Intronic
1101319407 12:103660084-103660106 CTCCCAACAGCCGTGTGAGGTGG - Intronic
1101950702 12:109172468-109172490 CTCACGACAGAAGTGTGAGGTGG - Intronic
1101991672 12:109490530-109490552 CTCACAACAACCCTGTGAGGTGG + Intronic
1102358647 12:112262902-112262924 CTAAAAACAGCTGGGTGTGGTGG - Intronic
1102929422 12:116851056-116851078 CTCACAACAGCCCTGTGATGGGG + Exonic
1103013467 12:117475921-117475943 CTTCCAACAGCTGTGTGAGTGGG + Intronic
1104093617 12:125536543-125536565 CTCACAACCAGTGTGTGAGGTGG - Intronic
1104662444 12:130620891-130620913 CTCACCACTGCTGGGTGGGGTGG - Intronic
1106449088 13:29863735-29863757 TTCACAACAAATGTGTGAGGTGG + Intergenic
1112334285 13:98501279-98501301 CACACCACAGCTCTGTGAGGAGG - Intronic
1112356421 13:98677805-98677827 CTCGCAGCAGCTGCTGGAGGTGG + Intergenic
1112850222 13:103696895-103696917 CTTACAACAGCTGTATGATGGGG + Intergenic
1113109529 13:106807531-106807553 CTCACATCAACTCCCTGAGGTGG - Intergenic
1114777921 14:25506216-25506238 CTGACAATAGCTGTATGAGGTGG + Intergenic
1115535797 14:34372037-34372059 CTCACAACAGCTACATGTGATGG - Intronic
1116269190 14:42739398-42739420 CTCTCAACAACTGTGTGAGTTGG + Intergenic
1117068967 14:52039270-52039292 CTCACAACAGCCTGGTGAGGTGG + Intronic
1117435715 14:55713598-55713620 CTCACAAGAGCTCTGTGAGGAGG + Intergenic
1120983303 14:90310415-90310437 CTCACAGCTGCTCTGTGAGGAGG - Intronic
1121036126 14:90705195-90705217 CTCACAACAGCTACATGAGTAGG - Intronic
1122306821 14:100771810-100771832 CCCACAACAGCCAGGTGAGGTGG + Intergenic
1124147780 15:27144514-27144536 GTCACAACACCTGCCTGAGATGG + Intronic
1124421073 15:29522869-29522891 ACCACAACAGCTGCTAGAGGTGG + Intronic
1124552160 15:30691656-30691678 CTCACACCAGCTCCGTGGGAGGG + Intronic
1124636646 15:31369368-31369390 TTCACAACAACTCCATGAGGTGG - Intronic
1124679081 15:31714010-31714032 CTCACACCAGCTCCGTGGGAGGG - Intronic
1125116128 15:36093753-36093775 CTCACAAGAACTCCATGAGGAGG + Intergenic
1126540435 15:49816542-49816564 CTCACAGCAACTCTGTGAGGTGG + Intergenic
1126957739 15:53953067-53953089 CTCACAACAGCTGCTTTCAGGGG + Intergenic
1127292015 15:57579614-57579636 CTCCCTGCAGCTGGGTGAGGAGG - Intergenic
1127486060 15:59418832-59418854 CTCACAGCAGTTCTGTGAGGAGG - Intronic
1128054994 15:64692718-64692740 CTCACTCCAGCTGGGTGTGGTGG - Intronic
1128555432 15:68628643-68628665 CCCACATCAGCTCCATGAGGAGG + Intronic
1128658546 15:69480830-69480852 CTCACAGAAGCTGGGTGTGGTGG + Intergenic
1128732074 15:70028029-70028051 CTCACAACAACTCCATGGGGTGG + Intergenic
1129102282 15:73277023-73277045 CTCACAACAGCTTTGTGAAGTGG + Intronic
1129883418 15:79022150-79022172 CTAAAAACAGCTGGGTGCGGTGG + Intronic
1130403225 15:83576442-83576464 CTCCCAACAGCAGTGTAAGGTGG + Intronic
1130923458 15:88367770-88367792 CTCACCACAGCACTGTGAGGAGG - Intergenic
1132385822 15:101399238-101399260 CTCTCAACAGCTGGGAGAGGTGG - Intronic
1134608927 16:15592561-15592583 ATCACATGAGCTGCCTGAGGCGG + Intronic
1135232944 16:20726771-20726793 CTCACCACAGCCTTGTGAGGTGG - Intronic
1135616421 16:23914630-23914652 CTCCCAACAGCCTTGTGAGGTGG - Intronic
1136070040 16:27782210-27782232 CCCACAACAGCTGAGTGTGGGGG - Intergenic
1137559318 16:49492765-49492787 CTCACAACAGCCTTGCGAGGTGG + Intronic
1137566177 16:49533817-49533839 CTCATAACAGCCCTGTGAGGTGG - Intronic
1137978306 16:53049306-53049328 CACACAACAGCTGGGGGTGGTGG - Intergenic
1139371908 16:66474189-66474211 CTCACAATAACTGTTTGAGGTGG - Intronic
1140457933 16:75115448-75115470 CCCAAAACAGATGAGTGAGGAGG + Intronic
1140916506 16:79498585-79498607 CTCACACCAGCTCCTTGAGATGG + Intergenic
1141010681 16:80395447-80395469 CACAAAACAGCTGGGTGTGGTGG + Intergenic
1141646139 16:85368930-85368952 CTCACAGCAGCTGCTTGGGCAGG - Intergenic
1141744454 16:85916181-85916203 CTCACAGCAGCCCAGTGAGGTGG + Intronic
1141815941 16:86409264-86409286 CACACAGCAGATGTGTGAGGAGG + Intergenic
1141895497 16:86956368-86956390 CTCTCACCAGCTGCATGAGATGG - Intergenic
1142212294 16:88814065-88814087 CTGACAACAGGTGCCTGAGGTGG - Exonic
1142776810 17:2146926-2146948 CTCACAACAGCTCTTTGAGCTGG + Intronic
1144292020 17:13835944-13835966 CTCACAACATGTGTGTGAGGTGG - Intergenic
1144653723 17:17022339-17022361 CTCCCAACAGCTGCAAGAGAAGG - Intergenic
1144654627 17:17027729-17027751 CTCACAACAACTGTCTGAGGAGG - Intergenic
1144814949 17:18027503-18027525 CTGACCACAGCTCCGTGAGGTGG + Intronic
1144909814 17:18672021-18672043 CTCATCACTGCTGCGTGACGTGG + Intronic
1145280142 17:21462139-21462161 TTCACAACAGCTGCATAAGGAGG - Intergenic
1145397745 17:22508345-22508367 TTCACAACAACTGCATAAGGAGG + Intergenic
1145907189 17:28522963-28522985 CTCACAACATCTGTGTGAGGTGG + Intronic
1146263882 17:31438461-31438483 CTCAAGGCAGCTGCATGAGGAGG - Intronic
1146489057 17:33266878-33266900 CACAGAACAGCAGAGTGAGGTGG + Intronic
1146497549 17:33336576-33336598 CTCACGACAGCTGTGTGGGGAGG + Intronic
1146591174 17:34129206-34129228 CTCACAACAGCCTAATGAGGTGG + Intronic
1146694398 17:34897761-34897783 CTTACAACAACTCTGTGAGGAGG - Intergenic
1147132291 17:38416556-38416578 CTTTCAACAGCTCTGTGAGGTGG + Intergenic
1148322381 17:46765348-46765370 TTCACAACAGCAGAGTGACGAGG + Intronic
1148324926 17:46777688-46777710 CTCACAACAACTCTGGGAGGTGG + Intronic
1151880122 17:76889718-76889740 CTCACTAGAGCTTGGTGAGGAGG + Intronic
1151917821 17:77131555-77131577 CCCACTACAGCTGGGTGTGGTGG - Intronic
1152752115 17:82067369-82067391 CTGACAACATGTGCCTGAGGTGG - Intergenic
1155398676 18:25415206-25415228 CTGTCAACAGCTGAGTGTGGTGG + Intergenic
1157156053 18:45267239-45267261 CTCCTATCAGCTGCATGAGGAGG - Intronic
1158935950 18:62364792-62364814 TTCACAACAGCACCATGAGGTGG + Intronic
1159972117 18:74667547-74667569 CTCACAGCAGCTGCATATGGTGG + Intronic
1160785229 19:897275-897297 CTGCCAAGAGCTGCGTGAGGAGG + Exonic
1160846394 19:1168000-1168022 CTCACCAGAGCTGGGGGAGGGGG + Intronic
1160884404 19:1338746-1338768 CTCAAAAAAGCTGGGTGCGGTGG + Intergenic
1161321800 19:3644831-3644853 GTCACAAGAGCTTGGTGAGGAGG - Intronic
1162898971 19:13782851-13782873 GTCACAATAGCTGGGTGTGGTGG - Intergenic
1163069385 19:14825763-14825785 CTGACTACAGCTTCATGAGGAGG + Intronic
1163128511 19:15257546-15257568 CTCCCACCAGATGCGTGCGGGGG + Intronic
1163713876 19:18863050-18863072 CCCCCCACAGCTTCGTGAGGTGG + Intronic
1165208742 19:34215204-34215226 CTCCCAACAGCTGCTGGAGCAGG - Exonic
1165363882 19:35352238-35352260 CGCAGAGCAGCAGCGTGAGGAGG - Exonic
1166706598 19:44911402-44911424 CTCACCAGGGCTGAGTGAGGAGG + Intergenic
1167605214 19:50478310-50478332 CTCACAGCAGCCATGTGAGGTGG + Intronic
1168391954 19:56016438-56016460 CTCAGCACAGCTGGGTGTGGTGG - Intronic
925035078 2:678713-678735 ATCACACCAGCTGGGTGCGGTGG - Intergenic
926085889 2:10020155-10020177 CTCACAGCAGCCTCGAGAGGCGG - Intergenic
926292715 2:11543436-11543458 CTCACTACAGCCGTGTAAGGTGG + Intronic
926357730 2:12056788-12056810 CTCACAACAGCCCCATGTGGGGG + Intergenic
927499688 2:23574425-23574447 CCCACAACAGCCCGGTGAGGTGG - Intronic
927842682 2:26455574-26455596 CTCACACCCGCTGTGTGAGGTGG + Intronic
928445581 2:31331066-31331088 TTCACAACAGCCCAGTGAGGTGG + Intergenic
928764008 2:34619911-34619933 CTCACAACTGCTTCATGAAGTGG + Intergenic
929537247 2:42791609-42791631 CTCACAGTAGCACCGTGAGGGGG - Intronic
929553403 2:42908352-42908374 CTCACCTCAGCTGCCTGAGTAGG - Intergenic
930257612 2:49109998-49110020 GTCAGAACAGTTGCATGAGGAGG + Intronic
932360295 2:71099536-71099558 TTCTCAACAGCTGGGTGCGGAGG - Intergenic
933347705 2:81110531-81110553 CTCACAATAGCTGGGTGTGGTGG + Intergenic
933694965 2:85210799-85210821 CTCACAACAGCCCTGTGAGGTGG + Intronic
933719310 2:85387313-85387335 CTCACAGCAACTCTGTGAGGTGG + Intronic
933841886 2:86293671-86293693 CTCAGTACAGCTGAGTGAGGGGG - Intronic
934073694 2:88409264-88409286 CTCACAGCAGCACTGTGAGGTGG + Intergenic
934528605 2:95069780-95069802 CTCACAACAGCCCCGAGAAGTGG - Intergenic
934664101 2:96158091-96158113 CCGACAACAGCAGGGTGAGGTGG - Intergenic
934858333 2:97742748-97742770 CTCAAAACATCTGCCTGGGGTGG + Intergenic
936833521 2:116678910-116678932 CTCACAACAACTGCTGGAGCTGG - Intergenic
939565916 2:143786351-143786373 CTCACAACAACGGCATTAGGTGG - Intergenic
939666761 2:144962582-144962604 CTTACATCAGCTGGATGAGGTGG - Intergenic
941580471 2:167291899-167291921 CTCACAACAACGTTGTGAGGTGG + Intergenic
941769383 2:169328917-169328939 CTCACAACAGCTTTGTGAGATGG + Intronic
944499214 2:200341136-200341158 CTCACAACAGCCCTGTGAGGTGG + Intronic
946466938 2:219920351-219920373 CTCACAGCAGCTGCACGAAGTGG - Intergenic
948174003 2:235928896-235928918 CTCACAGCAGCCGGGGGAGGTGG - Intronic
1168888824 20:1280525-1280547 GTCACAACTGCTGTATGAGGTGG + Intronic
1169037709 20:2467303-2467325 CTCCCCACAGGTGTGTGAGGGGG - Exonic
1169200830 20:3708758-3708780 CAAACAACAGCTGGGTGCGGTGG + Intergenic
1169414895 20:5407623-5407645 CTTACAACAACTGGTTGAGGTGG - Intergenic
1169701584 20:8453283-8453305 TTCACAACAGTTCTGTGAGGTGG - Intronic
1172329751 20:34067122-34067144 CTCACAACAGCCCTGTGAGGAGG - Intronic
1173184818 20:40832459-40832481 CTCACAACAGCCCAGTGAGGCGG + Intergenic
1173595463 20:44256225-44256247 CTCACAACAGCCCCTAGAGGAGG - Intronic
1173954296 20:47018732-47018754 CTTACAGCAACCGCGTGAGGTGG + Intronic
1174377866 20:50138490-50138512 CTCACAGGAGCTGCGTTGGGGGG - Intronic
1176676139 21:9779285-9779307 CCCACAACAGCTGTGAAAGGTGG + Intergenic
1178358648 21:31930255-31930277 CTCACAACAGCCATGTGAAGTGG - Intronic
1178739649 21:35186434-35186456 CTCACATCAGCCGGATGAGGTGG + Intronic
1178929460 21:36804962-36804984 CTCTTAACAGCTCCATGAGGTGG + Intronic
1179170938 21:38972289-38972311 CTCAATACAGCTGCTTGGGGTGG + Intergenic
1179260975 21:39757951-39757973 CACACACCAGCTGCGGGGGGTGG + Intronic
1181137570 22:20779349-20779371 ATCATAACATCTGCGTGGGGTGG + Exonic
1182330788 22:29550453-29550475 CTCACCACAGCCTCCTGAGGTGG + Intronic
1182584240 22:31334652-31334674 CTCATAACAGCCCTGTGAGGTGG + Intronic
1182924865 22:34112663-34112685 CTCAAAAAAGATGCATGAGGTGG + Intergenic
1183300103 22:37054661-37054683 CTCATGACAGCTCGGTGAGGTGG - Intronic
1184204220 22:42990972-42990994 CTCACAACAGCGTTGTGAGGTGG - Intronic
1184870130 22:47232511-47232533 CCCACAACAGCCCTGTGAGGTGG - Intergenic
950040955 3:9918767-9918789 CTCACAACAGCCATGTGAGGTGG + Intronic
950041053 3:9919663-9919685 CTCACAACAGTCATGTGAGGTGG - Intronic
950115026 3:10445216-10445238 CTCACACCATTTGCATGAGGTGG + Intronic
950479751 3:13236986-13237008 CTCACAACACCTGCCCGAGGAGG + Intergenic
950525439 3:13520251-13520273 CTCACAACAGCTGTGGGAGGAGG - Intergenic
950613895 3:14144116-14144138 CTCACAACAACTTTGTGAGGTGG - Intronic
952511137 3:34057363-34057385 CTCACGAAAGCTGCCTGGGGTGG - Intergenic
952605698 3:35144879-35144901 CTCTCAGCAGCTGGGTGTGGGGG + Intergenic
954995010 3:54873138-54873160 CTCAGAACAGCTCTATGAGGTGG - Intronic
955214116 3:56970934-56970956 CTCACAACAGCCCTGTGAGAGGG - Intronic
956027203 3:64995951-64995973 CTCAAAACAGCTGCAGGGGGTGG - Intergenic
956750686 3:72341789-72341811 CCCACTAGAGCTGTGTGAGGTGG - Intergenic
957456245 3:80451647-80451669 CTTACAACAGCTCAGTGAGTTGG - Intergenic
957911531 3:86624964-86624986 CTGACAACATGTGCCTGAGGTGG + Intergenic
957980458 3:87502823-87502845 CACACAAAAGCTGAGAGAGGAGG - Intergenic
960025959 3:113009737-113009759 ATCACAAAAGCTCTGTGAGGTGG - Intronic
960621572 3:119642138-119642160 CTCACAACAACCCTGTGAGGTGG + Exonic
960807805 3:121600757-121600779 CTCACAACAACCATGTGAGGTGG - Intronic
961180458 3:124872379-124872401 CTCACAATAGCTCTGTCAGGTGG - Intronic
961440998 3:126953095-126953117 CTCTCAACAGCTCTGTGGGGTGG + Intronic
963065694 3:141261979-141262001 CCCAGGACAGCTGTGTGAGGAGG + Intronic
963194529 3:142511824-142511846 CACAAAACAGCTGGGTGCGGTGG + Intronic
963601913 3:147385882-147385904 CTCACAATGGCTGCTTTAGGGGG + Intergenic
964745758 3:160011017-160011039 CTCAAAACAGCTGCAGGAGATGG + Intergenic
966872446 3:184299601-184299623 CTCACCACCGCCGCGTGAAGTGG + Intronic
967006658 3:185390263-185390285 CTCACAGCAGCTCTGTGTGGTGG + Intronic
967035917 3:185648167-185648189 TTTACAACAGCTGGGTGTGGTGG + Intronic
968280077 3:197470172-197470194 CTCATAACAGCCCTGTGAGGCGG - Intergenic
969840746 4:9879975-9879997 CTCACAGAAGCTGCCTCAGGCGG + Intronic
972458039 4:39273167-39273189 CTCACAGCAGCTCCATGAAGTGG + Intronic
972576302 4:40355357-40355379 CTCACAACAACTCTGTGAGTTGG + Intergenic
975690994 4:76963346-76963368 TTCACAACAACTTTGTGAGGTGG + Intronic
977785824 4:101033982-101034004 CTGAGAACAGCTGTGGGAGGAGG - Intronic
977912527 4:102554692-102554714 CGCAAGACAGCTGCATGAGGAGG - Intronic
978368022 4:108002975-108002997 CTCACAACAGTTTTATGAGGTGG + Intronic
980070017 4:128234140-128234162 CTCACAACAACTCTGTGGGGTGG - Intergenic
985747026 5:1653493-1653515 GTCACAAGAGCTACGGGAGGCGG - Intergenic
987557388 5:19471942-19471964 CTCACAACAACCCTGTGAGGTGG + Intergenic
987647945 5:20700226-20700248 CTGACAACAGCTGTGAGATGGGG - Intergenic
988748391 5:34168634-34168656 CTGACAACAGCTGTGAGATGGGG + Intergenic
988836586 5:35038572-35038594 CTCCTGACAGCTGCCTGAGGGGG + Intronic
989183945 5:38604777-38604799 CTGACAACATGTGCGTAAGGTGG + Intronic
994212764 5:97104517-97104539 CTCACAATAACTGTATGAGGTGG - Intronic
997030057 5:130117108-130117130 CTCACTACAGTGGTGTGAGGAGG + Intronic
997596709 5:135111958-135111980 CTCACAGCAACTCAGTGAGGTGG - Intronic
997935537 5:138107354-138107376 CTCACAACAGCTCTGTGAGATGG + Intergenic
998397518 5:141828284-141828306 CTTGCAACAGCTTTGTGAGGCGG + Intergenic
998449380 5:142222591-142222613 CTCACAGCAGATGTGAGAGGTGG + Intergenic
999667304 5:153926705-153926727 CTCACAATAGCTGTGTGGTGTGG + Intergenic
1000200155 5:159001551-159001573 CTCATAACAGCCTTGTGAGGTGG - Intronic
1000301713 5:159962563-159962585 CTGACAACAGCTCCCTGAGCAGG - Intronic
1000934240 5:167288664-167288686 CTCACAACAGCTTTGCGAGGTGG + Intronic
1001042814 5:168348969-168348991 CTCCCCACAGCTCTGTGAGGTGG + Intronic
1001493402 5:172171361-172171383 CTCACAACAGCTTCTGGAGGAGG - Intronic
1001713355 5:173795123-173795145 CTCACAACAGCCCCGTTATGAGG - Intergenic
1002170689 5:177372430-177372452 CTCATACCAGCTTCCTGAGGAGG - Exonic
1002427129 5:179182994-179183016 CCCACAACAGCTTTGTGATGGGG - Intronic
1003618143 6:7673518-7673540 CTCACAAGAACTGCATAAGGTGG - Intergenic
1004473620 6:15950865-15950887 CTCACAACAGCACCATGAGGTGG + Intergenic
1004504677 6:16238486-16238508 CTCTCAACCCCTGCCTGAGGCGG + Intergenic
1004660823 6:17707502-17707524 CTCACAACAGCTTTATAAGGTGG - Intergenic
1006102604 6:31695010-31695032 CTCACAACAGCTGAGTGAGGTGG - Intronic
1006603107 6:35238874-35238896 GGCCCAACAGCTGCGAGAGGAGG + Intronic
1007043433 6:38747171-38747193 CTCACATCAGCTGGATCAGGTGG + Intronic
1007749022 6:44060696-44060718 CTCACAACAGCCAGGTGAGGTGG - Intergenic
1008170006 6:48193336-48193358 CTCAGAAGAGCTGCTTAAGGTGG - Intergenic
1009016673 6:57912523-57912545 CTGACAACAGCTGTGAGATGGGG + Intergenic
1011626517 6:89287623-89287645 CTCACAACGGCTGGCTAAGGTGG + Intronic
1013283851 6:108663717-108663739 CTCATCACTGCTGCGTGACGTGG - Exonic
1015174387 6:130290712-130290734 CTCACAACAGCTCTGTAAGGTGG - Intronic
1019515285 7:1437272-1437294 CTCACAACAGCTGCGTGAGGTGG + Intronic
1020680749 7:11233781-11233803 CTGACAACATGTGCCTGAGGTGG + Intergenic
1021943978 7:25707342-25707364 CTCACAACAACTATGTGAGGTGG + Intergenic
1022154492 7:27645667-27645689 GTCAGAACAGCCGGGTGAGGTGG - Intronic
1022532408 7:31075316-31075338 CTCACAGCAGCCCTGTGAGGCGG + Intronic
1023301553 7:38778007-38778029 GTGATAACAGCTGCGTAAGGAGG - Intronic
1029526352 7:101096562-101096584 CTCACAGCAGCTCTGTGAAGTGG - Intergenic
1030164701 7:106542416-106542438 CCCACAAGAGCTGCATAAGGTGG - Intergenic
1031967416 7:128036982-128037004 CTCACAACAGCTCTGTGAGATGG + Intronic
1032581312 7:133105844-133105866 CTCACAGCAGCTGGGAGATGAGG - Intergenic
1032920904 7:136545634-136545656 CACATAACAGCTGCTTGAGAGGG + Intergenic
1033715876 7:144001743-144001765 CTCATAATTGCTGCGTGAGTGGG - Intergenic
1033851540 7:145502238-145502260 CTCATTACTGCTGCGGGAGGGGG + Intergenic
1034941886 7:155236149-155236171 CTCTCAACAGCTGTGCTAGGTGG + Intergenic
1034948360 7:155279183-155279205 CTCCCAAATGCTGCGTGATGGGG - Intergenic
1035557521 8:577988-578010 CTCACCCCTGCTGCATGAGGTGG - Intergenic
1035754761 8:2022936-2022958 CTCACAACTGTTGGGTGCGGAGG - Intergenic
1037099823 8:15031541-15031563 CTCACAACAACCCTGTGAGGTGG + Intronic
1037977532 8:23224383-23224405 GCCACACCAGCTGCGTGAAGGGG - Intronic
1039622750 8:39013787-39013809 CTCATAACAGCTGGGTGCAGTGG - Intronic
1040633107 8:49239185-49239207 CACACAAAAGCTGGGTGTGGTGG + Intergenic
1042510454 8:69605837-69605859 CTCACAACTGTAGAGTGAGGTGG + Intronic
1042811414 8:72829546-72829568 CTCACCACAGCTGTATAAGGAGG + Intronic
1043553372 8:81401047-81401069 CACACAATAGCTGGGTGTGGTGG - Intergenic
1044859541 8:96509206-96509228 CTCACAACACCTCTATGAGGTGG - Intronic
1045608889 8:103811731-103811753 CTCGCAACAGCTGGGTGTGGTGG - Intronic
1048846897 8:138610730-138610752 CTCAGAACAGGTGTGTGAGGTGG - Intronic
1048982833 8:139712250-139712272 CTCACAGCAACTGTGTGAGCCGG - Intergenic
1049407567 8:142458428-142458450 CTCACAGCTTCTGCATGAGGTGG - Intronic
1049519872 8:143082630-143082652 CTCACAACAGGGCCCTGAGGAGG - Exonic
1049563940 8:143327720-143327742 TTCACGACAGCTTTGTGAGGTGG - Intronic
1049680656 8:143916536-143916558 CGCACAGAAGCTGCGTGACGTGG - Exonic
1050122938 9:2326469-2326491 TTCACAACAGCCCTGTGAGGTGG - Intergenic
1050408406 9:5334920-5334942 CTAACAACAGTTACATGAGGTGG - Intergenic
1052673174 9:31584324-31584346 ATCACAACAACTCTGTGAGGTGG + Intergenic
1053131797 9:35619461-35619483 CTCCCCACAGCTGCAGGAGGGGG - Intronic
1053300505 9:36945852-36945874 CTCTCAACAGCCCTGTGAGGCGG - Intronic
1053472407 9:38356380-38356402 CTCACTGCAGCTCCATGAGGTGG + Intergenic
1056366421 9:85909441-85909463 CTCACCACTGCTGCTAGAGGAGG - Intergenic
1056660375 9:88538837-88538859 CTCACAACAACTCCAGGAGGTGG + Intronic
1058166880 9:101629751-101629773 CTCATAATAGCTTCGTGAAGAGG + Intronic
1059385111 9:113958545-113958567 CTCACAATGGCTCTGTGAGGTGG + Intronic
1060087566 9:120715379-120715401 CTCACAACAGCTCTGTGAGGGGG - Intergenic
1060301169 9:122375385-122375407 CCCTCAACAGCTGTCTGAGGTGG - Intronic
1060732122 9:126045403-126045425 CTCACAACAGCCCTGTGAGGTGG + Intergenic
1060877504 9:127093822-127093844 CGCACCACACCTGCATGAGGCGG + Exonic
1060990706 9:127847154-127847176 CTCACAGCAGCCTTGTGAGGTGG + Intronic
1061160764 9:128892591-128892613 CTCACCCCAGCTGGGTGTGGGGG + Intronic
1061543395 9:131290180-131290202 GTCACAGCAGCTGCCAGAGGAGG + Exonic
1061895541 9:133645150-133645172 TTCACAATAGCTGTGGGAGGTGG - Intronic
1062126341 9:134864982-134865004 GTCCCACCAGCTGTGTGAGGAGG + Intergenic
1062272987 9:135718263-135718285 CTCACAGGAGCCGTGTGAGGTGG + Intronic
1062440341 9:136566834-136566856 ATCACAACAGCCCTGTGAGGTGG + Intergenic
1185893693 X:3841136-3841158 CTCACATCAGGTGCAAGAGGTGG - Intronic
1185898808 X:3879560-3879582 CTCACATCAGGTGCAAGAGGTGG - Intergenic
1185903925 X:3917989-3918011 CTCACATCAGGTGCAAGAGGTGG - Intergenic
1189263184 X:39692587-39692609 CTCACAACAGCCCTATGAGGTGG - Intergenic
1189375032 X:40459886-40459908 CTCACAATGGCAGGGTGAGGAGG + Intergenic
1191955322 X:66637803-66637825 CTCACAACAGCCCCATGAGGTGG + Intronic
1198033718 X:132780670-132780692 CTCACAACAACTCCATTAGGTGG - Intronic
1198338756 X:135693349-135693371 CTCACAATGGCTCTGTGAGGTGG - Intergenic
1200049139 X:153419479-153419501 CTCTCATCAGCTGCGTGAGGTGG - Intronic