ID: 1019516297

View in Genome Browser
Species Human (GRCh38)
Location 7:1441643-1441665
Sequence CTGGACACCACCAGGGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 241}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019516287_1019516297 11 Left 1019516287 7:1441609-1441631 CCACCGGGGGGGACGGAGCACAG 0: 1
1: 0
2: 1
3: 11
4: 100
Right 1019516297 7:1441643-1441665 CTGGACACCACCAGGGGGACAGG 0: 1
1: 0
2: 1
3: 22
4: 241
1019516286_1019516297 14 Left 1019516286 7:1441606-1441628 CCACCACCGGGGGGGACGGAGCA 0: 1
1: 0
2: 0
3: 9
4: 160
Right 1019516297 7:1441643-1441665 CTGGACACCACCAGGGGGACAGG 0: 1
1: 0
2: 1
3: 22
4: 241
1019516290_1019516297 8 Left 1019516290 7:1441612-1441634 CCGGGGGGGACGGAGCACAGGGC 0: 1
1: 0
2: 1
3: 36
4: 276
Right 1019516297 7:1441643-1441665 CTGGACACCACCAGGGGGACAGG 0: 1
1: 0
2: 1
3: 22
4: 241
1019516284_1019516297 19 Left 1019516284 7:1441601-1441623 CCAGACCACCACCGGGGGGGACG 0: 1
1: 0
2: 0
3: 0
4: 47
Right 1019516297 7:1441643-1441665 CTGGACACCACCAGGGGGACAGG 0: 1
1: 0
2: 1
3: 22
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019516297 Original CRISPR CTGGACACCACCAGGGGGAC AGG Intronic
900189137 1:1345929-1345951 CTCGGCACCACCCAGGGGACAGG - Intronic
900369937 1:2327784-2327806 CTGGTCACCGCCAGAGGCACAGG - Intronic
900516599 1:3085167-3085189 CTGGACACCACCATGTGCAGAGG + Intronic
900581501 1:3412040-3412062 CTGGACACGACCACGGGGACGGG + Exonic
900678978 1:3905786-3905808 CTGGAGACCACAAGGGCGTCGGG - Intergenic
900971689 1:5995489-5995511 CTGGACACACCCAAGGGCACTGG - Intronic
901309327 1:8257119-8257141 CAGGAGACCACCAGGGTGATGGG - Intergenic
901518846 1:9768215-9768237 CTGGACGGCACCATGGGGGCGGG + Intronic
901518915 1:9768431-9768453 CTGGGCGGCACCAGGGGGGCGGG + Intronic
902925950 1:19695758-19695780 CTGAAAACCCCCAGGAGGACTGG + Intronic
906569356 1:46822935-46822957 CTGGACAGAACCTGGGGGAGGGG - Intergenic
909615803 1:77606569-77606591 GTGGCCACCACCACTGGGACTGG - Intronic
910112843 1:83700909-83700931 ATGGACCCCACCTGGGGGTCTGG + Intergenic
913566691 1:120079999-120080021 CTGGGCAGCAGCAGGGGGAGAGG - Intergenic
913631440 1:120713553-120713575 CTGGGCAGCAGCAGGGGGAGAGG + Intergenic
914287449 1:146240706-146240728 CTGGGCAGCAGCAGGGGGAGAGG - Intergenic
914548481 1:148691448-148691470 CTGGGCAGCAGCAGGGGGAGAGG - Intergenic
914618198 1:149380263-149380285 CTGGGCAGCAGCAGGGGGAGAGG + Intergenic
916717936 1:167460850-167460872 CTGGGAGACACCAGGGGGACAGG + Intronic
917477866 1:175384423-175384445 CTGGGCACCCCCTGGGTGACAGG + Intronic
918150057 1:181790669-181790691 CAGGACACCTCCAGGGCAACTGG - Intronic
921387803 1:214588447-214588469 CAGGAAACAACCAGGTGGACAGG - Intergenic
921499899 1:215888776-215888798 ATGGACACTCCCAGGGGCACCGG - Exonic
922702672 1:227771009-227771031 CTGGCCACCCCCAAGGTGACTGG + Intronic
924032311 1:239898249-239898271 CTGGTCACCAGCATGGGGAACGG + Intronic
924718510 1:246601461-246601483 CTGGACTCCACCAGGGGTCTAGG - Intronic
924732460 1:246724441-246724463 CCGAACACCACCAGGTGGAAAGG - Exonic
924909686 1:248497178-248497200 CTGGACAGAACCTGGGGGAGGGG - Intergenic
924914416 1:248550882-248550904 CTGGACAGAACCTGGGGGAGGGG + Intergenic
1062994794 10:1855770-1855792 CCTGACAGCACCAGGGGGAGTGG + Intergenic
1063100251 10:2944345-2944367 CCGGACACCACCAGGCTGCCTGG - Intergenic
1063462595 10:6224044-6224066 GTGGCCACCTTCAGGGGGACAGG - Intronic
1067805013 10:49386321-49386343 CTGGACAGCACCAGTGGCCCTGG + Intronic
1069363066 10:67666170-67666192 CTGGACACTACCTGGGTAACGGG - Intronic
1070666662 10:78349854-78349876 CAGGACACCACTTGGAGGACAGG - Intergenic
1074118317 10:110474477-110474499 GTGGCCACCAGAAGGGGGACTGG - Intergenic
1074829444 10:117238621-117238643 ATGCTCACTACCAGGGGGACAGG - Intergenic
1076784721 10:132744095-132744117 CCAGACACCACCAGGGAAACAGG + Intronic
1077046998 11:551116-551138 CTGGGCACCTGCAGGGGGAGGGG - Exonic
1077315204 11:1916603-1916625 GTGGACAGCACCAGGGGCAGGGG + Intergenic
1077512537 11:2976456-2976478 CTGGACACCACCATGGGACTTGG - Intronic
1077534984 11:3119730-3119752 CTGGACACCCCCAGGGCCACAGG + Intronic
1077603923 11:3594227-3594249 CTGGACACCAGCAAAGGGTCTGG - Intergenic
1083255204 11:61491256-61491278 CTGGACACCAACACGGGGGTGGG + Intergenic
1083726710 11:64632199-64632221 CTGGACCCCACAAGTGGGAAGGG - Intronic
1083938493 11:65882712-65882734 CTGGACATCTGCAGGGGGACAGG + Intronic
1084006883 11:66327873-66327895 CTGGACACACACATGGGGACAGG - Intergenic
1084101286 11:66951329-66951351 CTGCAGACCAGCAGGGGGAGAGG + Intronic
1084189560 11:67492886-67492908 CAGGACCCCACCAGGGGGCAGGG - Intronic
1084697233 11:70762962-70762984 CTGCACACCACCATGAGGCCCGG + Intronic
1084969767 11:72764727-72764749 CTGGAGAGCACCAGGTGGGCGGG + Intronic
1088244013 11:107799433-107799455 CTGGCCACCACTAGGGGTGCTGG - Intronic
1089366865 11:117925988-117926010 CTGCACACCTGCAGGGGCACAGG + Intronic
1089454179 11:118616218-118616240 CTGGACACCTCCAGATGGAGGGG + Intronic
1091700242 12:2654260-2654282 CTGGACACAAACAGGGGTGCTGG - Intronic
1091705165 12:2688699-2688721 CTGGGCACCATGAGGGAGACGGG - Exonic
1095955280 12:47802450-47802472 CTTTTCACCAGCAGGGGGACTGG - Intronic
1096007426 12:48184171-48184193 GTGGACACCTCCAGGGGCGCCGG - Exonic
1096194720 12:49642507-49642529 CTGGACACCGCCATGAGCACAGG - Exonic
1097457690 12:59820255-59820277 CTGTACAAAACCAGGGGGAAAGG + Intergenic
1097491590 12:60278446-60278468 CCGGACAGCACTAGGGGGATGGG + Intergenic
1100474467 12:94922790-94922812 CTGGTAACCCCCAGGGGGCCTGG - Intronic
1101736670 12:107468405-107468427 CAGGAGACCACCAGGGCCACAGG + Intronic
1102208285 12:111105558-111105580 CTGCACACCCCCAGGGAGATGGG + Intronic
1103590731 12:121990332-121990354 GTGGGCAACACCAGGGGCACAGG + Intronic
1103916705 12:124379514-124379536 CTGGGGACTCCCAGGGGGACTGG + Intronic
1103996160 12:124831577-124831599 CAGGAGACCACCAGGGGCCCTGG + Intronic
1104900421 12:132187119-132187141 CTGGACACCCTCACGGGCACTGG - Intergenic
1105210093 13:18252568-18252590 CTGGATATCACCAGGGGCACTGG - Intergenic
1105415956 13:20211460-20211482 TTTGACACCACCTGGGGGAGGGG - Intergenic
1106475915 13:30098020-30098042 CTGGACAGCAGCACGGGGTCTGG - Intergenic
1112385354 13:98934282-98934304 CTTGAGACCACCATGGTGACAGG + Intronic
1114713877 14:24804708-24804730 CTGGAGACCACCCCGGGGAGGGG - Intergenic
1114723198 14:24905128-24905150 CTGGAGACCAGAAGAGGGACAGG + Intronic
1118763157 14:68892866-68892888 CTGAACACCTGCAGGGGGCCAGG + Intronic
1119542717 14:75451248-75451270 CTGGAGGCCTCCTGGGGGACTGG + Intronic
1122070891 14:99204623-99204645 CTGGACACCTCCCAGGGGCCAGG + Intronic
1122104464 14:99441687-99441709 CTGATCACCACCAGAGGGAGTGG + Intronic
1122243927 14:100387803-100387825 TTGGACACCACCTGGGTGAAGGG - Intronic
1122899804 14:104777756-104777778 CTGGCAACCACAAGGGGGCCTGG + Intronic
1124252468 15:28115911-28115933 CTGCACACCCTCAGTGGGACAGG + Intronic
1124405025 15:29384605-29384627 CTGGGCACCTCCAGGGAGGCTGG + Intronic
1125760679 15:42093805-42093827 CTGGCCACCACCTGGGGCACCGG + Intronic
1127943721 15:63728239-63728261 CAGGTAAGCACCAGGGGGACAGG - Intronic
1128062468 15:64743566-64743588 CAGGAGACCCCCAGGGGGCCAGG + Intronic
1129001790 15:72341586-72341608 CTGTGCACCACCAGGGGGTGGGG - Exonic
1129525549 15:76211652-76211674 CTGGAGACCACTGGGTGGACTGG - Intronic
1132112792 15:99114716-99114738 CAGGCCACACCCAGGGGGACTGG - Intronic
1132323119 15:100941905-100941927 CAGGTCACCAGCAGGGCGACTGG - Intronic
1132343462 15:101092550-101092572 CTGGACCCCACAATGGAGACTGG - Intergenic
1132556358 16:574427-574449 CTGGTCCTCACCAGGGGCACCGG - Exonic
1132598298 16:763029-763051 CGGGACTCCACCAGGGAGCCCGG - Intronic
1134014064 16:10876539-10876561 CTTGATACCACCAGGAGGATGGG + Intergenic
1136994632 16:35181397-35181419 CTGGACACCAGGAGGGGAAGAGG - Intergenic
1137057938 16:35754273-35754295 CTGGGCCCCAGCAGGGGCACAGG - Intergenic
1139481255 16:67231951-67231973 ATGCCCACCACCAGAGGGACAGG + Intronic
1140034518 16:71362039-71362061 CTAGACCCCACCAGGGTCACTGG - Intronic
1141392758 16:83678358-83678380 CTGGTCACCATCATGGGGTCTGG - Exonic
1142112907 16:88341640-88341662 CTGCACACCTGCAGGTGGACTGG + Intergenic
1142141033 16:88472981-88473003 CTGGACCCCACCAGGACGAGGGG + Intronic
1142463823 17:115619-115641 CTGGACACCCTCAGTGGGGCTGG - Intergenic
1142766307 17:2066121-2066143 CTGCACTCCACCAGTGGGGCTGG - Intronic
1143373933 17:6456446-6456468 CTGGACACAGCCAGAAGGACTGG - Intronic
1143569912 17:7750325-7750347 CTGGACAGAAGCAGGAGGACAGG - Intronic
1143601935 17:7952725-7952747 CTGAAGACCACCAAGGAGACTGG + Intergenic
1145316207 17:21736404-21736426 CAGGACACCACCATGGGGTGGGG + Intergenic
1145714637 17:27008332-27008354 CAGGACACCACCATGGGGTGGGG + Intergenic
1147237286 17:39067283-39067305 CTGGACACCAGCAAGGGTCCAGG + Exonic
1147645595 17:42031847-42031869 CTGGAGCCCAGCAGGGGGACAGG + Intronic
1147767725 17:42848110-42848132 CTGGACACCAGCTGGGGTAACGG - Intronic
1147975702 17:44247069-44247091 CTGGACATCACCTGGGGATCTGG + Intergenic
1149685194 17:58531183-58531205 CTGGGCACCTCCAGGGAGGCTGG + Intronic
1150228152 17:63534862-63534884 CTGGACACCCCCTGCTGGACAGG - Intronic
1151560655 17:74867874-74867896 CTGGAAAGCACCAGGAGGTCAGG + Intronic
1152347248 17:79760679-79760701 CTGGACAGCAGCAGGGGCCCAGG - Intergenic
1152558245 17:81065304-81065326 CTGGACCCCTGCAGGGGGCCGGG - Intronic
1152760104 17:82103309-82103331 CAGGACCCCAGCAGGGGGCCAGG - Intronic
1154335775 18:13463322-13463344 CTGCACACCTCCAGGGAGGCGGG - Intronic
1161045274 19:2131257-2131279 CTAGACACCTCCAGGTGGACAGG + Intronic
1161045368 19:2131638-2131660 CTAGACACCTCCAGGCGGACAGG + Intronic
1161045382 19:2131695-2131717 CTAGACACCTCCGGGCGGACAGG + Intronic
1161045397 19:2131752-2131774 CTAGACACCTCCGGGCGGACAGG + Intronic
1161045412 19:2131809-2131831 CTAGACACCTCCGGGCGGACAGG + Intronic
1161045426 19:2131866-2131888 CTAGACACCTCCGGGCGGACAGG + Intronic
1161455564 19:4368157-4368179 CTGGGGAGCACCAGGGGCACAGG - Intronic
1162479928 19:10922098-10922120 CTGGAGACAGGCAGGGGGACAGG - Exonic
1163491279 19:17618413-17618435 CTGGACACCATCAAGGTGAGAGG - Exonic
1164686511 19:30169674-30169696 CTGGGCACCAGCAGGGGCAAAGG + Intergenic
1164889820 19:31813768-31813790 CTGGACACCACGAGTGGGGTGGG + Intergenic
1165158756 19:33803676-33803698 CAGGACACCAGCAAGGGGGCCGG - Intronic
1165388407 19:35524999-35525021 CTGGTCCCCTCCAGGGTGACTGG + Intronic
1166249286 19:41556048-41556070 CTGGACTCCACAAGGAGAACAGG + Intronic
1166498782 19:43326051-43326073 TTGGGCACCACAAGGGGGATAGG + Intergenic
1167539608 19:50076934-50076956 CTGCACCCCACCATGGGAACTGG - Intergenic
1167630104 19:50620937-50620959 CCGCACCCCACCATGGGGACTGG + Intergenic
1168557251 19:57353426-57353448 CTGGACAACACCAGGAGAACTGG + Intronic
928660685 2:33499217-33499239 CTGGACAAAGCCAGGGAGACAGG - Intronic
930006870 2:46904658-46904680 CTAGATACCAACAGGGGTACAGG - Exonic
931236091 2:60413646-60413668 CTAGACACCATCCGAGGGACAGG + Intergenic
932582309 2:72999885-72999907 CTGGACAACAGAAGGGTGACTGG + Intronic
932736832 2:74260266-74260288 CTGGACACCAGGAGTGGCACAGG - Intronic
935069839 2:99684366-99684388 CTGGACAGCTGCAGGGGGAGGGG - Intronic
935243045 2:101194564-101194586 CTGGACACCTCCAGGGGCCTGGG - Intronic
936151157 2:110023153-110023175 CTGGGCAGGAGCAGGGGGACCGG - Intergenic
936193518 2:110348216-110348238 CTGGGCAGGAGCAGGGGGACCGG + Intergenic
936561001 2:113539802-113539824 CTGCACTCCACCTGGGTGACAGG + Intergenic
937393487 2:121514023-121514045 CTAGACACCAGCATGGGGCCAGG + Intronic
937428080 2:121816410-121816432 CTGGCCACCATCAGGGAGAAGGG + Intergenic
938256278 2:129862110-129862132 CTGGCCACCAGCAGGGGCTCAGG - Intergenic
938717535 2:134034721-134034743 CTGGCCACCACCATGGTAACTGG + Intergenic
942783826 2:179676590-179676612 CTGGAGAGCAGCGGGGGGACAGG + Intronic
945521542 2:210833664-210833686 CTGGAAACCTCCAGGGTAACTGG - Intergenic
945985981 2:216353973-216353995 CTGGAAGCCACCAGAGGGTCTGG - Intronic
946238677 2:218340920-218340942 CTGGACACCAGCAGGGAGGGAGG + Intronic
946408549 2:219505435-219505457 CTGGGGACCGCAAGGGGGACAGG - Intronic
948642667 2:239385450-239385472 CTGGCCACCAACAGGGAGCCGGG - Intronic
1168877466 20:1181343-1181365 GGAGACACCCCCAGGGGGACTGG + Exonic
1170029027 20:11925006-11925028 CTGGACACTGCCAGGGACACAGG - Exonic
1171291239 20:23984258-23984280 CTGGATATCACCAGGGGCACTGG - Intergenic
1171371219 20:24663475-24663497 CTCAACACCACCAGAGAGACTGG + Intronic
1171393167 20:24814552-24814574 CTGGACTCCACTAGGAGGAGAGG - Intergenic
1171517128 20:25746751-25746773 ATGGGCACCACCTGAGGGACAGG - Intergenic
1173146295 20:40527429-40527451 CTGGACACTCCAAGAGGGACAGG - Intergenic
1174334456 20:49849121-49849143 CTCGAAGCCACCAGTGGGACTGG + Intronic
1175699298 20:61125457-61125479 ATGGGCCCCACCAGGGGGAGGGG + Intergenic
1176062952 20:63180147-63180169 CAGGACAACACCAAAGGGACTGG + Intergenic
1176161716 20:63652021-63652043 CTGGACACCCCCGGGGATACTGG - Intronic
1176312253 21:5158292-5158314 TCGGACACCAGCATGGGGACGGG + Intergenic
1178497425 21:33099165-33099187 CTGTACCCCAGCCGGGGGACAGG + Intergenic
1179844795 21:44103738-44103760 TCGGACACCAGCATGGGGACGGG - Exonic
1180766164 22:18346836-18346858 CTGGATATCACCAGGGGCACTGG + Intergenic
1180780149 22:18515542-18515564 CTGGATATCACCAGGGGCACTGG - Intergenic
1180812865 22:18772863-18772885 CTGGATATCACCAGGGGCACTGG - Intergenic
1181199023 22:21207111-21207133 CTGGATATCACCAGGGGCACTGG - Intergenic
1181400721 22:22648677-22648699 CTGGATATCACCAGGGGCACTGG + Intergenic
1181702701 22:24629775-24629797 CTGGATATCACCAGGGGCACTGG + Intergenic
1182385650 22:29938424-29938446 CTGGACACCAGCTGAGGGAGAGG + Intronic
1183367548 22:37415201-37415223 TTTGGCATCACCAGGGGGACAGG - Intronic
1183707585 22:39483895-39483917 GTGGACAGCTCCAGGGGGGCAGG + Intronic
1183975393 22:41508991-41509013 CAGGATACCACCAGGGGGCCAGG - Intronic
1185009951 22:48307272-48307294 CTGGGCCCCACCAGGAGGATGGG + Intergenic
1203227782 22_KI270731v1_random:87727-87749 CTGGATATCACCAGGGGCACTGG + Intergenic
950438103 3:12992746-12992768 CTGGACAAGGCCAGGGGGAGGGG + Intronic
950450754 3:13063758-13063780 CTGCATCCCACCAGGGGCACTGG - Intronic
950515116 3:13460137-13460159 CTGGACCCCACACGGGGGAAGGG + Intergenic
952555554 3:34526012-34526034 CTGGACACCACCACTGGGCAAGG + Intergenic
953032250 3:39186498-39186520 CTGGACCCCAGCATGGGGATGGG - Exonic
957566857 3:81895140-81895162 CTGTACACCAGCAGGGCTACTGG + Intergenic
958871567 3:99564953-99564975 CTGAAGACCACCTGGGGTACGGG - Intergenic
959605456 3:108236859-108236881 CTGGAGAACACCAGTGGGGCTGG + Intergenic
961978140 3:131048290-131048312 CTGGACAGAACCTGGGGGAGGGG - Intronic
967929394 3:194679781-194679803 CAGGACTCCACCAGTGAGACGGG - Intergenic
968885537 4:3329170-3329192 TTGGAGAGCACCAGGGGGTCAGG + Intronic
969598838 4:8163789-8163811 CTGGAGACCCCCTGGGGGAGTGG - Intergenic
969702159 4:8773656-8773678 CTGGCCTCCACCAGGCGGGCTGG - Intergenic
970589992 4:17551366-17551388 CTGCACTCCACCATGGTGACAGG + Intergenic
972097387 4:35364781-35364803 CTGGACAGAACCTGGGGGAAGGG - Intergenic
974420263 4:61663464-61663486 CTGCACACCACCAGGCACACCGG - Intronic
976002669 4:80389921-80389943 CTGGAAACCACCAGGGACTCTGG - Intronic
976178160 4:82374484-82374506 GTGGACAGCGCCAGGGGCACAGG - Intronic
977232846 4:94472642-94472664 CTGGCCACCACCAGGGATGCAGG - Intronic
980309061 4:131102348-131102370 CTGGACACCATGATGGTGACAGG - Intergenic
981240876 4:142474509-142474531 CTGGATACCAGCAGTGGGAGTGG - Intronic
984501439 4:180564295-180564317 CTGGATAACACCAAGGGGATTGG - Intergenic
990270361 5:54131053-54131075 CTGGACACCCCAAGGGCTACAGG - Intronic
994822855 5:104676477-104676499 CTGGACAAAACCTGGGGGAGGGG + Intergenic
1000254335 5:159523599-159523621 CTGTACATCACCAATGGGACAGG - Intergenic
1001544678 5:172563626-172563648 CTGGACAGCACCTGGGGGTGTGG - Intergenic
1001899825 5:175417386-175417408 CTGGAAACCACCTGGGACACAGG - Intergenic
1002495999 5:179612011-179612033 CTGGACACTAGCAGAGGGAAGGG - Intergenic
1007687289 6:43674400-43674422 CTGGGAACCACCAGCTGGACAGG + Intronic
1015347780 6:132180026-132180048 CTGGACAGAACCTGGGGGAGGGG + Intergenic
1017718101 6:157225809-157225831 CTGGACACGTCGAGGGGCACAGG + Intergenic
1019055765 6:169222246-169222268 GTGAACTCCACCACGGGGACGGG - Exonic
1019516297 7:1441643-1441665 CTGGACACCACCAGGGGGACAGG + Intronic
1019516323 7:1441713-1441735 CGGGACACCACAGGGGGGACGGG + Intronic
1020260726 7:6529467-6529489 CTGGTTCCCACCTGGGGGACAGG - Intronic
1022466478 7:30655888-30655910 CTTGACCCCACAATGGGGACAGG - Intronic
1025189705 7:56887305-56887327 CTGGCCACCCCGAGGGGGCCCGG + Intergenic
1025682233 7:63689616-63689638 CTGGCCACCCCGAGGGGGCCCGG - Intergenic
1029547030 7:101216069-101216091 CTGGAGACAGCCTGGGGGACAGG - Intronic
1034410714 7:150940714-150940736 CTGTCCACCACCAGGGGAAAAGG + Intergenic
1034680453 7:152924461-152924483 CTGGAAACCCCCAGGGGCCCTGG - Intergenic
1036281631 8:7405599-7405621 TTGGACACCACAGGGGGGATAGG - Intergenic
1036339839 8:7905973-7905995 TTGGACACCACAGGGGGGATAGG + Intergenic
1037840840 8:22244617-22244639 CAGGACTCCACCAGGAGCACAGG + Intergenic
1038036588 8:23691430-23691452 GTGGACAGGACCTGGGGGACTGG + Intergenic
1039585482 8:38703702-38703724 GTGGAAATCACCAGGGCGACTGG - Intergenic
1039899463 8:41740952-41740974 CTGGTCCCCAGGAGGGGGACAGG + Intronic
1039978588 8:42387712-42387734 CTGGACAGGACTAGAGGGACAGG + Intergenic
1040022867 8:42756102-42756124 CTGGACAAGACAAGGGGCACAGG - Exonic
1041269122 8:56093713-56093735 CATGACACCAGCAAGGGGACAGG - Intergenic
1042748980 8:72137557-72137579 CTGGACATCAGCAGGAGTACGGG - Intergenic
1043023544 8:75037139-75037161 CTGGACATTTCCATGGGGACAGG + Intergenic
1043516059 8:80996189-80996211 CTGCCCACGACCACGGGGACTGG - Intronic
1043743315 8:83842070-83842092 CTGGAGACGACCACTGGGACAGG - Intergenic
1045832427 8:106479540-106479562 CTGCACAGTACCAGGGGGATTGG - Intronic
1047051483 8:121117842-121117864 CTGGACAAAGCCATGGGGACAGG + Intergenic
1049179296 8:141212879-141212901 CTGGAGACCACCAGGGTGAGGGG - Intronic
1049454163 8:142678564-142678586 CTGGCCAGAACCCGGGGGACAGG + Intronic
1049891679 9:75524-75546 CTGCACTCCACCTGGGTGACAGG - Intergenic
1053733106 9:41076615-41076637 CTGCACTCCACCTGGGTGACAGG - Intergenic
1054624681 9:67385985-67386007 CTGGACCCCAGCAGGGTGAAAGG - Intergenic
1054695316 9:68354948-68354970 CTGCACTCCACCTGGGTGACAGG + Intronic
1055029407 9:71758403-71758425 CTGTACCCCACCAGGGGGTTGGG - Intronic
1056779539 9:89538941-89538963 CAGGTCACCAGCAGAGGGACGGG + Intergenic
1057171709 9:92966762-92966784 CTGGACACCCCCAGCTGGGCAGG + Intronic
1059182138 9:112226283-112226305 CTGGAGACCAGCAGGGAGGCCGG + Intronic
1059353467 9:113682565-113682587 CTGGAAACCACCGGGAGAACTGG - Intergenic
1061135418 9:128730671-128730693 CTGGACAGCAGCAGGGCCACTGG + Exonic
1061674401 9:132207691-132207713 CTGGACACAAGCAGGGTGCCAGG + Intronic
1061971802 9:134049194-134049216 CTGCACACCCCCAGGAGGCCTGG - Intronic
1061980507 9:134100545-134100567 CTGGACCCGGCCAGGGGGAGAGG - Intergenic
1186136492 X:6527350-6527372 CTGGTCACCAGCAGGGGTACAGG - Intergenic
1186461497 X:9751960-9751982 CTGGCCCCCAGCAGGGGCACAGG - Intronic
1186604192 X:11072128-11072150 CTGGACACCAGCAGGGCTGCTGG - Intergenic
1186963012 X:14757823-14757845 CTGGACAGAACCTGGGGGAGAGG + Intergenic
1187232576 X:17436645-17436667 CAGGAAACCACCAAGGGGAGAGG - Intronic
1188727632 X:33606221-33606243 CTGCACACAACCAGGCAGACCGG + Intergenic
1190916426 X:54814512-54814534 CTGGGCAAGACCAGTGGGACAGG + Intronic
1194660838 X:96627193-96627215 TTGGACACCACCGGGTGGATAGG - Intergenic
1197150667 X:123217067-123217089 CTGAACACTACCGGGGGGACAGG - Intronic
1197961888 X:132016093-132016115 GTGGACAACACCAGAGGGAGAGG - Intergenic
1200143050 X:153911155-153911177 CTCTCCACCACCAGGGGCACAGG + Exonic
1200958409 Y:8973352-8973374 CTGGACACCAACACGGGGAGTGG + Intergenic