ID: 1019516599

View in Genome Browser
Species Human (GRCh38)
Location 7:1442876-1442898
Sequence TGTCAGAGGCTGGGCCGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019516579_1019516599 22 Left 1019516579 7:1442831-1442853 CCCCCTAAACACACCACCCACCC 0: 1
1: 0
2: 4
3: 49
4: 442
Right 1019516599 7:1442876-1442898 TGTCAGAGGCTGGGCCGGCCTGG No data
1019516586_1019516599 9 Left 1019516586 7:1442844-1442866 CCACCCACCCAGGCTGGAGGCAC 0: 1
1: 1
2: 7
3: 53
4: 380
Right 1019516599 7:1442876-1442898 TGTCAGAGGCTGGGCCGGCCTGG No data
1019516587_1019516599 6 Left 1019516587 7:1442847-1442869 CCCACCCAGGCTGGAGGCACCTG 0: 1
1: 1
2: 2
3: 42
4: 308
Right 1019516599 7:1442876-1442898 TGTCAGAGGCTGGGCCGGCCTGG No data
1019516592_1019516599 2 Left 1019516592 7:1442851-1442873 CCCAGGCTGGAGGCACCTGGGGC 0: 1
1: 0
2: 2
3: 61
4: 712
Right 1019516599 7:1442876-1442898 TGTCAGAGGCTGGGCCGGCCTGG No data
1019516578_1019516599 25 Left 1019516578 7:1442828-1442850 CCACCCCCTAAACACACCACCCA 0: 1
1: 0
2: 1
3: 42
4: 444
Right 1019516599 7:1442876-1442898 TGTCAGAGGCTGGGCCGGCCTGG No data
1019516582_1019516599 19 Left 1019516582 7:1442834-1442856 CCTAAACACACCACCCACCCAGG 0: 1
1: 0
2: 2
3: 39
4: 333
Right 1019516599 7:1442876-1442898 TGTCAGAGGCTGGGCCGGCCTGG No data
1019516593_1019516599 1 Left 1019516593 7:1442852-1442874 CCAGGCTGGAGGCACCTGGGGCT 0: 1
1: 0
2: 3
3: 60
4: 440
Right 1019516599 7:1442876-1442898 TGTCAGAGGCTGGGCCGGCCTGG No data
1019516588_1019516599 5 Left 1019516588 7:1442848-1442870 CCACCCAGGCTGGAGGCACCTGG 0: 1
1: 2
2: 3
3: 39
4: 684
Right 1019516599 7:1442876-1442898 TGTCAGAGGCTGGGCCGGCCTGG No data
1019516581_1019516599 20 Left 1019516581 7:1442833-1442855 CCCTAAACACACCACCCACCCAG 0: 1
1: 0
2: 2
3: 38
4: 350
Right 1019516599 7:1442876-1442898 TGTCAGAGGCTGGGCCGGCCTGG No data
1019516580_1019516599 21 Left 1019516580 7:1442832-1442854 CCCCTAAACACACCACCCACCCA 0: 1
1: 0
2: 2
3: 44
4: 396
Right 1019516599 7:1442876-1442898 TGTCAGAGGCTGGGCCGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019516599 Original CRISPR TGTCAGAGGCTGGGCCGGCC TGG Intronic
No off target data available for this crispr