ID: 1019517236

View in Genome Browser
Species Human (GRCh38)
Location 7:1445413-1445435
Sequence GGAGCACTGCTTACACCTGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1094
Summary {0: 1, 1: 0, 2: 4, 3: 92, 4: 997}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019517232_1019517236 -7 Left 1019517232 7:1445397-1445419 CCGAGTGCAGCGTGCAGGAGCAC 0: 1
1: 0
2: 0
3: 11
4: 172
Right 1019517236 7:1445413-1445435 GGAGCACTGCTTACACCTGGGGG 0: 1
1: 0
2: 4
3: 92
4: 997
1019517223_1019517236 21 Left 1019517223 7:1445369-1445391 CCCGGCTCTCCTGTGGCCTTGTA 0: 1
1: 0
2: 1
3: 24
4: 244
Right 1019517236 7:1445413-1445435 GGAGCACTGCTTACACCTGGGGG 0: 1
1: 0
2: 4
3: 92
4: 997
1019517224_1019517236 20 Left 1019517224 7:1445370-1445392 CCGGCTCTCCTGTGGCCTTGTAG 0: 1
1: 0
2: 1
3: 25
4: 259
Right 1019517236 7:1445413-1445435 GGAGCACTGCTTACACCTGGGGG 0: 1
1: 0
2: 4
3: 92
4: 997
1019517226_1019517236 12 Left 1019517226 7:1445378-1445400 CCTGTGGCCTTGTAGGCCCCCGA 0: 1
1: 0
2: 0
3: 2
4: 63
Right 1019517236 7:1445413-1445435 GGAGCACTGCTTACACCTGGGGG 0: 1
1: 0
2: 4
3: 92
4: 997
1019517227_1019517236 5 Left 1019517227 7:1445385-1445407 CCTTGTAGGCCCCCGAGTGCAGC 0: 1
1: 0
2: 0
3: 6
4: 85
Right 1019517236 7:1445413-1445435 GGAGCACTGCTTACACCTGGGGG 0: 1
1: 0
2: 4
3: 92
4: 997
1019517230_1019517236 -5 Left 1019517230 7:1445395-1445417 CCCCGAGTGCAGCGTGCAGGAGC 0: 1
1: 0
2: 0
3: 9
4: 99
Right 1019517236 7:1445413-1445435 GGAGCACTGCTTACACCTGGGGG 0: 1
1: 0
2: 4
3: 92
4: 997
1019517229_1019517236 -4 Left 1019517229 7:1445394-1445416 CCCCCGAGTGCAGCGTGCAGGAG 0: 1
1: 0
2: 1
3: 5
4: 85
Right 1019517236 7:1445413-1445435 GGAGCACTGCTTACACCTGGGGG 0: 1
1: 0
2: 4
3: 92
4: 997
1019517231_1019517236 -6 Left 1019517231 7:1445396-1445418 CCCGAGTGCAGCGTGCAGGAGCA 0: 1
1: 0
2: 1
3: 14
4: 134
Right 1019517236 7:1445413-1445435 GGAGCACTGCTTACACCTGGGGG 0: 1
1: 0
2: 4
3: 92
4: 997

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019517236 Original CRISPR GGAGCACTGCTTACACCTGG GGG Exonic
900302766 1:1986293-1986315 AGAGAATTGCTTAAACCTGGAGG + Intronic
900770562 1:4539948-4539970 GGAGAATTGCTTAAACCTGGGGG - Intergenic
900984047 1:6063108-6063130 GGAGAATCGCTTGCACCTGGAGG - Intronic
901713699 1:11136042-11136064 GGAGAATTGCTTGAACCTGGAGG + Intronic
901803965 1:11726182-11726204 GGAGAATTGCTTGAACCTGGGGG - Intergenic
902175435 1:14646646-14646668 GGGACACTGCTGACATCTGGTGG - Intronic
902177797 1:14664340-14664362 TGAGAATTGCTTAAACCTGGGGG + Intronic
902183597 1:14708640-14708662 ACAGCTCTGCTTACACATGGTGG + Intronic
902763161 1:18597583-18597605 GGAGCAATGCTGTCACCTAGTGG - Intergenic
903162670 1:21500523-21500545 GGAGAATTGCTTGAACCTGGAGG + Intergenic
903585729 1:24414132-24414154 GGAGCATCGCTTGAACCTGGAGG - Intronic
904145231 1:28385451-28385473 GGAGAATTGCTTGAACCTGGAGG + Intronic
904177882 1:28643957-28643979 AGAGAACTGCTTAAACCTGGAGG + Intergenic
904178681 1:28650064-28650086 GGAGAATTGCTTGCACCGGGAGG + Intergenic
904226428 1:29024539-29024561 AGAGAATTGCTTAAACCTGGAGG + Intronic
904240525 1:29141714-29141736 GGAGAATTGCTTGAACCTGGGGG - Intergenic
904245386 1:29184263-29184285 GGAGAATTGCTTGAACCTGGAGG - Intergenic
904613972 1:31739977-31739999 GGAGGACTTCATTCACCTGGTGG - Exonic
904992535 1:34604927-34604949 GGAGAATTGCTTGAACCTGGGGG - Intergenic
905117393 1:35654030-35654052 AGAGAATTGCTTAAACCTGGAGG + Intergenic
905210669 1:36371905-36371927 GGAGAATTGCTTGAACCTGGAGG + Intronic
905724781 1:40242053-40242075 AGAGAACTGCTTAAACCTGGAGG - Intergenic
906138328 1:43516552-43516574 AGAGAATTGCTTAAACCTGGGGG - Intergenic
906373762 1:45277025-45277047 GGAGAATTGCTTGAACCTGGGGG + Intronic
906449195 1:45930167-45930189 AGAGAATTGCTTAAACCTGGAGG - Intronic
906478696 1:46186578-46186600 GGAGAACTGCTTGAACCCGGAGG - Intergenic
906969604 1:50497638-50497660 AGAGAATTGCTTAAACCTGGGGG - Intronic
907012404 1:50976724-50976746 GAAGCCAGGCTTACACCTGGGGG + Intergenic
907013691 1:50990368-50990390 GGAGAATTGCTTGCACCGGGAGG - Intergenic
907279484 1:53337171-53337193 GGAGAATTGCTTGAACCTGGGGG - Intergenic
907488339 1:54792522-54792544 GGAGAATTGCTTAAACCCGGAGG - Intronic
907783494 1:57589126-57589148 GGAGAATTGCTTGAACCTGGGGG + Intronic
908096309 1:60742666-60742688 TGAGCACAGGTTACACCAGGAGG - Intergenic
908136983 1:61143478-61143500 GGAGGACTGCTTGAACCTGGGGG - Intronic
908180135 1:61595650-61595672 GGAGAATTGCTTGAACCTGGTGG - Intergenic
908292637 1:62683835-62683857 GGAGAATCGCTTAAACCTGGGGG + Intronic
908761772 1:67519333-67519355 GGAGAAGTGCTTGAACCTGGGGG + Intergenic
908905889 1:69008136-69008158 GGAGAAATGCTTGAACCTGGAGG + Intergenic
909242658 1:73235018-73235040 GGAGAATCGCTTAAACCTGGGGG - Intergenic
909740912 1:79028895-79028917 AGAGAACTGCTTGAACCTGGAGG - Intergenic
909837393 1:80274280-80274302 GGAGAATTGCTTGAACCTGGGGG - Intergenic
909944987 1:81654034-81654056 GGAGAATTGCTTGAACCTGGGGG - Intronic
909957348 1:81796079-81796101 GGAGAATTGCTTGAACCTGGGGG - Intronic
910325278 1:85999530-85999552 GGAGGACTGCTTGAGCCTGGAGG + Intronic
910361345 1:86415939-86415961 GGCACCCTGCCTACACCTGGAGG + Intergenic
910884626 1:91951680-91951702 AGAGAATTGCTTAAACCTGGAGG + Intronic
910973295 1:92878914-92878936 GGAAAACTGCTTGAACCTGGGGG + Intronic
911026928 1:93446427-93446449 GGAGAATTGCTTGAACCTGGGGG + Intergenic
911697719 1:100911638-100911660 GGAGAATCGCTTACACCAGGAGG - Intronic
912480767 1:109980830-109980852 GGAGCACAGCCTCCCCCTGGTGG + Intergenic
912489228 1:110052558-110052580 GGAGAATCGCTTAAACCTGGGGG - Intronic
912647101 1:111403621-111403643 GGAGAATTGCTTGAACCTGGAGG - Intergenic
912823454 1:112885417-112885439 GGAGAATTGCTTGAACCTGGAGG + Intergenic
913166075 1:116187023-116187045 GGAGAATTGCTTGAACCTGGGGG - Intergenic
914229972 1:145756924-145756946 TGAGAATTGCTTAAACCTGGAGG - Intronic
915433792 1:155887773-155887795 GGAGAATTGCTTGAACCTGGAGG - Intergenic
915583033 1:156827171-156827193 GGAGGATTGCTTGCACCTGGGGG - Intronic
916011052 1:160706163-160706185 GGAGAATTGCTTGAACCTGGGGG - Intronic
916560245 1:165928854-165928876 GGAGAATTGCTTGAACCTGGAGG - Intergenic
917102420 1:171459720-171459742 GGAGAATTGCTTCAACCTGGTGG - Intergenic
917350678 1:174074089-174074111 GGAGGATTGCTTGAACCTGGGGG + Intergenic
917807200 1:178624595-178624617 AGAGAATTGCTTAAACCTGGAGG + Intergenic
917888303 1:179410319-179410341 GGAGAATTGCTTGAACCTGGGGG - Intronic
918244750 1:182649007-182649029 GGAGAATTGCTTGAACCTGGGGG + Intronic
918265342 1:182837302-182837324 GGAGAATTGCTTGAACCTGGAGG - Intergenic
918275665 1:182952064-182952086 GGAGAATTGCTTGCACCGGGAGG + Intronic
918436197 1:184515901-184515923 GGAGAATTGCTTAAACCTGGAGG - Intronic
918629940 1:186704800-186704822 GGAGAATTGCTTGAACCTGGAGG - Intergenic
919113003 1:193243034-193243056 GGGGAACTGCTTGAACCTGGGGG - Intronic
919673149 1:200356182-200356204 GAAGGACTGTTTACAGCTGGAGG - Intergenic
919929390 1:202211450-202211472 GGAGAATTGCTTGAACCTGGGGG - Intronic
920023951 1:202978213-202978235 GGAGAATTGCTTGAACCTGGGGG + Intergenic
920130067 1:203725236-203725258 GGAGAATTGCTTGAACCTGGAGG - Intronic
920275124 1:204798862-204798884 GGATCACTGCTCACTGCTGGTGG - Intergenic
920440495 1:205977561-205977583 GGAGCACTGCTGCCCTCTGGTGG + Exonic
920521168 1:206627915-206627937 GGAGAACTGCTTGAACCTGGGGG - Intergenic
920933120 1:210407397-210407419 GGGGCACTGCTGCCCCCTGGTGG - Intronic
921689766 1:218134876-218134898 GGAGTATCGCTTGCACCTGGGGG + Intergenic
921906048 1:220496546-220496568 GGAGAATTGCTTGTACCTGGGGG - Intergenic
922109357 1:222542451-222542473 GGAGAATTGCTTGAACCTGGAGG - Intronic
922638494 1:227202071-227202093 GGAGAATTGCTCACACCCGGAGG - Intronic
923142736 1:231174944-231174966 GCAGCACTGCTCACAACTAGGGG - Intronic
923597203 1:235369734-235369756 GGAGAATTGCTTGAACCTGGGGG + Intronic
923718472 1:236447345-236447367 GGAGAATTGCTTGAACCTGGAGG - Intronic
924237739 1:242013265-242013287 GGAGAATTGCTTGAACCTGGGGG + Intergenic
924290758 1:242534206-242534228 GAAGCACTCCTAAAACCTGGGGG + Intergenic
924540493 1:244976176-244976198 GGAGAATTGCTTGAACCTGGGGG + Intronic
924856876 1:247882753-247882775 GGAGAATTGCTTGAACCTGGGGG + Intergenic
1063451100 10:6150906-6150928 GGAGAACCGCTTGAACCTGGGGG + Intronic
1063704523 10:8418052-8418074 GGAGGATTGCTTGCACCAGGAGG - Intergenic
1063715983 10:8527575-8527597 GGAGCACTGCTTGAACCCGGGGG + Intergenic
1063724654 10:8623520-8623542 GGAGAATTGCTTGAACCTGGGGG - Intergenic
1064081466 10:12311337-12311359 GGAGCACTGCAGGCAGCTGGAGG - Intergenic
1064393744 10:14963185-14963207 GGAGAATTGCTTGAACCTGGGGG - Intronic
1064759271 10:18601881-18601903 GGAGAACTGCTTCAACCCGGAGG + Intronic
1064886163 10:20114775-20114797 GGAGCACAGGATACATCTGGAGG + Intronic
1065003475 10:21358581-21358603 GGAGAATTGCTTGAACCTGGGGG - Intergenic
1065344348 10:24734683-24734705 AGAGAATTGCTTAAACCTGGAGG - Intergenic
1065885326 10:30071685-30071707 GGAGAATTGCTTGAACCTGGGGG + Intronic
1066057648 10:31696800-31696822 GGAGAATTGCTTGAACCTGGGGG + Intergenic
1066477779 10:35764576-35764598 GGAGAACTGCTTCAACCTGGGGG + Intergenic
1066503337 10:36016461-36016483 GGAGAATTGCTTGAACCTGGGGG - Intergenic
1066548496 10:36528054-36528076 GGAGAATTGCTTGAACCTGGGGG + Intergenic
1066672002 10:37849978-37850000 GGAGAATTGCTTGAACCTGGGGG + Intronic
1067000809 10:42611248-42611270 GGAGAAATGCTTGAACCTGGGGG + Intronic
1067241129 10:44495056-44495078 AGAGAATTGCTTAAACCTGGAGG + Intergenic
1067361462 10:45583912-45583934 AGAGAATTGCTTAAACCTGGAGG + Intronic
1067462588 10:46468635-46468657 GGAGCGCTGCACACACCTGAGGG - Intergenic
1067624607 10:47916002-47916024 GGAGCGCTGCACACACCTGAGGG + Intergenic
1067998501 10:51303908-51303930 GGAGAATTGCTTGAACCTGGGGG - Intronic
1069006159 10:63319852-63319874 GGAGAATTGCTTGAACCTGGAGG - Intronic
1069707651 10:70468825-70468847 GGAGAATTGCTTGAACCTGGGGG - Intergenic
1069967323 10:72131326-72131348 GGAGAATTGCTTCAACCTGGGGG + Intronic
1069990499 10:72312555-72312577 GGAGAATTGCTTGAACCTGGAGG - Intergenic
1070110786 10:73484960-73484982 GGAGAATTGCTTGAACCTGGGGG + Intronic
1070539248 10:77404367-77404389 TGAGAATTGCTTGCACCTGGTGG - Intronic
1070846610 10:79527548-79527570 GGAGAATTGCTTGAACCTGGGGG + Intergenic
1071489472 10:86126361-86126383 AGAGAATTGCTTAAACCTGGAGG + Intronic
1072026717 10:91467251-91467273 GGTGAACTGCTTACACATGTGGG + Intronic
1072153734 10:92704778-92704800 GGAGAATTGCTTGAACCTGGAGG + Intergenic
1072417147 10:95258408-95258430 AGAGAATTGCTTAAACCTGGAGG + Intronic
1072537270 10:96373230-96373252 GGAGAATTGCTTGAACCTGGAGG - Intronic
1072881609 10:99234256-99234278 GGAGCGCTCCTTCCACGTGGAGG - Intronic
1073264585 10:102218226-102218248 GGAGAATTGCTTGAACCTGGGGG - Intergenic
1073303745 10:102486875-102486897 GGAGGACTGCTTGAGCCTGGGGG - Intronic
1073360776 10:102896715-102896737 AGAGAATTGCTTAAACCTGGAGG + Intronic
1073411535 10:103346103-103346125 GGAGAATTGCTTGAACCTGGAGG + Intronic
1073460794 10:103664755-103664777 GGAGAATTGCTTGAACCTGGGGG - Intronic
1074507420 10:114083732-114083754 GGAGAATTGCTTGAACCTGGAGG + Intergenic
1075381550 10:122023118-122023140 GGAGAACTGCTTGAACCCGGGGG - Intronic
1075764055 10:124878897-124878919 GGAGAATTGCTTAAACCCGGGGG + Intergenic
1077084671 11:743187-743209 GGAGGATTGCTTGAACCTGGGGG - Intergenic
1077153525 11:1081714-1081736 GGACACCTGCTCACACCTGGAGG + Intergenic
1077314428 11:1911349-1911371 GGAGAATTGCTTGAACCTGGGGG + Intergenic
1077513552 11:2986281-2986303 GGAGAACTGCTTGAACCTGGGGG + Intronic
1079060263 11:17242278-17242300 GGAGAATTGCTTGAACCTGGAGG + Intronic
1079434484 11:20433709-20433731 GGAGAATTGCTTGAACCTGGGGG - Intronic
1079478602 11:20857872-20857894 GGAGCACTGAATACACCAGTAGG + Intronic
1079482444 11:20895595-20895617 AGAGAAATGCTTAAACCTGGAGG - Intronic
1080416551 11:32074547-32074569 GGAGAATTGCTTAAACCCGGAGG - Intronic
1080651865 11:34229026-34229048 GGAGAATTGCTTAAATCTGGGGG + Intronic
1080931874 11:36819575-36819597 GGAGAATTGCTTGAACCTGGAGG - Intergenic
1081092088 11:38884079-38884101 GGAGAACTGCTTGAACCGGGAGG - Intergenic
1081497553 11:43630893-43630915 GGAGAATTGCTTGAACCTGGGGG - Intronic
1081623017 11:44630292-44630314 GGAGAATTGCTTGAACCTGGAGG - Intergenic
1081951300 11:47045875-47045897 GGAGAATTGCTTAAACCCGGGGG - Intronic
1082107990 11:48241855-48241877 GGAGTGCTGCTTACATCTAGTGG - Intergenic
1082259304 11:50065314-50065336 GGAGAATTGCTTGAACCTGGGGG - Intergenic
1083319946 11:61839411-61839433 GGAGAACTGCTTGAACCTGGAGG - Intronic
1083347567 11:62004226-62004248 AGAGAATTGCTTAAACCTGGAGG - Intergenic
1083358558 11:62087089-62087111 GGAGAACTGTTTGAACCTGGGGG - Intergenic
1083435785 11:62642119-62642141 GGAGAACTGCTTGAACCAGGAGG + Intronic
1083576977 11:63798978-63799000 AGAGAATTGCTTAAACCTGGAGG - Intergenic
1083603735 11:63964488-63964510 GGAGAATTGCTTGAACCTGGGGG - Intergenic
1083700436 11:64473906-64473928 GGAGAATTGCTTGAACCTGGGGG + Intergenic
1084051637 11:66603934-66603956 GGAGAATTGCTTGAACCTGGGGG + Intronic
1084454715 11:69261866-69261888 AGAGAATTGCTTAAACCTGGAGG - Intergenic
1084598642 11:70132071-70132093 GGAGCCCTGCTTACCCCAGAGGG - Exonic
1084617629 11:70246927-70246949 GGAGAACTGCTTGAACCAGGAGG + Intergenic
1084706233 11:70817434-70817456 GGGGCACTGCTCTTACCTGGTGG - Intronic
1085065580 11:73492549-73492571 GGAGGATTGCTTAAGCCTGGAGG + Intronic
1085595308 11:77803686-77803708 GGAGAATTGCTTAAACCTGAAGG + Intronic
1085837142 11:79969086-79969108 GGAGAATTGCTTGAACCTGGAGG + Intergenic
1086067847 11:82765340-82765362 AGAGAATTGCTTAAACCTGGAGG - Intergenic
1086082681 11:82921667-82921689 GGAGAATTGCTTGAACCTGGGGG - Intronic
1086265142 11:84989264-84989286 GGAGAATTGCTTGAACCTGGGGG - Intronic
1086316264 11:85596296-85596318 GGAGAACTGCTTGAACCGGGAGG + Intronic
1086463387 11:87028425-87028447 GGAGAATTGCTTGAACCTGGAGG + Intergenic
1086597033 11:88585049-88585071 GGTGCCCTTCTTAGACCTGGAGG + Intronic
1086888499 11:92228637-92228659 GGAGCACTCCTCAGACCTGCTGG - Intergenic
1087757132 11:102066046-102066068 GGAGAACTGCTTGAACCTGGTGG - Intronic
1088091015 11:106039866-106039888 GGAGAATTGCTTGAACCTGGGGG + Intergenic
1088632770 11:111789727-111789749 GGAGAATTGCTTGAACCTGGGGG + Intronic
1088688459 11:112304743-112304765 GGAGAATTGCTTAAACCAGGAGG - Intergenic
1089073910 11:115721742-115721764 GGAGCTCTGCTTCCTGCTGGTGG - Intergenic
1089230637 11:116971993-116972015 AGAGAACTGCTTAAACCTGGAGG + Intronic
1089316834 11:117597537-117597559 GGAGAATTGCTTGAACCTGGGGG - Intronic
1089507599 11:118974293-118974315 GGAGCATTGCTTGAGCCTGGAGG - Intronic
1089597973 11:119594050-119594072 GGAGAATTGCTTGAACCTGGGGG - Intergenic
1090370687 11:126249638-126249660 GGAGAATTGCTTGAACCTGGCGG + Intronic
1090853625 11:130592841-130592863 GGAGCACTCCTTGCTCCTGCTGG + Intergenic
1092097076 12:5851592-5851614 GGAGAATTGCTTGAACCTGGGGG + Intronic
1092138972 12:6169685-6169707 GGAGAATTGCTTGAACCTGGGGG - Intergenic
1092207257 12:6622335-6622357 GGAGAATTGCTTGAACCTGGGGG + Intronic
1092215705 12:6680555-6680577 GGAGAACTGCTTGAACCGGGAGG + Intronic
1092224350 12:6737554-6737576 GGAGAACTGTTTGAACCTGGAGG + Intergenic
1092366357 12:7880208-7880230 GGAGAACAGCTTGAACCTGGAGG + Intronic
1092377311 12:7966720-7966742 GGAGAATTGCTTAAACCCGGGGG + Intergenic
1093452672 12:19333697-19333719 GGAGAATTGCTTGAACCTGGGGG - Intronic
1093634944 12:21454789-21454811 AAAGCACTGCTTACCCCTGGGGG + Intronic
1093910708 12:24743691-24743713 GGAGAAATGCTTGAACCTGGAGG + Intergenic
1093950126 12:25156012-25156034 GGAGAACTGCTTGACCCTGGAGG + Intronic
1094124206 12:27005888-27005910 GGAGAATTGCTTGAACCTGGAGG - Intronic
1094124248 12:27006226-27006248 GGAGAATTGCTTGAACCTGGAGG - Intronic
1094613982 12:32019787-32019809 GGAGAATTGCTTAAACCTGGAGG - Intergenic
1094679896 12:32658699-32658721 AGAGAACTGCTTAAACCTGAAGG + Intergenic
1094693117 12:32788949-32788971 GGAGAATTGCTTGAACCTGGGGG + Intergenic
1095390863 12:41704957-41704979 GGAAAATTGCTTAAACCTGGGGG - Intergenic
1095461742 12:42451437-42451459 GGAGGACTGCTTGAGCCTGGGGG - Intronic
1095497938 12:42805098-42805120 TGATCACTGCAGACACCTGGTGG + Intergenic
1095721453 12:45405815-45405837 GGAGAATTGCTTGAACCTGGAGG + Intronic
1095951162 12:47782683-47782705 GGCGCACTGCTCACTTCTGGGGG + Exonic
1096006197 12:48174163-48174185 GGAGAATTGCTTGAACCTGGAGG + Intronic
1097210273 12:57362909-57362931 GGAGAACTGCTTGAACCAGGAGG - Intronic
1097420471 12:59372603-59372625 AGAGAATTGCTTAAACCTGGGGG - Intergenic
1097461976 12:59873218-59873240 GGAAGACTGCTGACTCCTGGTGG + Intergenic
1097504498 12:60448642-60448664 GGAGAATTGCTTGAACCTGGGGG - Intergenic
1097866802 12:64565791-64565813 GGAGAACTGCTTTTACCTGGAGG + Intergenic
1097919423 12:65055682-65055704 GGGGAATCGCTTACACCTGGGGG + Intronic
1098231097 12:68372521-68372543 GGAGAATTGCTTATCCCTGGAGG + Intergenic
1098250752 12:68567452-68567474 GGAGAATTGCTTGAACCTGGGGG + Intergenic
1098256030 12:68616534-68616556 GGAGATCTGCTTGAACCTGGAGG - Intronic
1098321259 12:69245994-69246016 GGAGAATTGCTTGAACCTGGGGG + Intronic
1099184635 12:79504016-79504038 GGAGAATTGCTTGAACCTGGGGG - Intergenic
1099455603 12:82859156-82859178 GGAGAATTGCTTGAACCTGGGGG - Intronic
1099913819 12:88866826-88866848 GGAGGATGGCTTGCACCTGGGGG - Intergenic
1100476869 12:94943090-94943112 GGAGAATTGCTTGAACCTGGGGG - Intronic
1100502922 12:95191824-95191846 GGAGAATTGCTTGAACCTGGAGG - Intronic
1100517515 12:95342556-95342578 GGAGAACTGCTTGAACCGGGAGG + Intergenic
1100903723 12:99273666-99273688 AGAGAATTGCTTAAACCTGGAGG - Intronic
1101235902 12:102789844-102789866 GGAGAATTGCTTGTACCTGGGGG - Intergenic
1101611688 12:106298610-106298632 GGAGAATTGCTTGAACCTGGGGG - Intronic
1101913531 12:108879095-108879117 GGAGAATTGCTTGAACCTGGTGG - Intronic
1102040869 12:109800031-109800053 GGAGAATTGCTTGAACCTGGGGG - Intronic
1102122632 12:110454441-110454463 GGAGAATTGCTTGAACCTGGAGG - Intronic
1102710690 12:114924010-114924032 GGAGAACCGCTTGAACCTGGGGG - Intergenic
1102838493 12:116091032-116091054 GGAGAATTGCTTGAACCTGGAGG + Intronic
1103075897 12:117982376-117982398 GGAGAATTGCTTGAACCTGGAGG - Intergenic
1103241489 12:119417028-119417050 GGAGAATTGCTTAAACCTGGAGG + Intronic
1103659718 12:122503989-122504011 GGAGGACTGCTTGAGCCTGGGGG + Intergenic
1103659796 12:122504533-122504555 GGAGAATTGCTTGAACCTGGGGG + Intergenic
1103674978 12:122648647-122648669 GGAGGATTGCTTGAACCTGGAGG + Intergenic
1103999580 12:124852052-124852074 GGATCCCTGCTTCCTCCTGGAGG + Intronic
1104317204 12:127714466-127714488 GGAGAATTGCTTGAACCTGGGGG - Intergenic
1104461995 12:128963553-128963575 GGAGAATTGCTTAAACCCGGGGG + Intronic
1105035222 12:132915019-132915041 AGAGAACTGCTTGTACCTGGAGG - Intronic
1105553998 13:21428309-21428331 GGAGAATTGCTTGAACCTGGAGG - Intronic
1105617920 13:22037387-22037409 GGAGAATTGCTTGAACCTGGGGG + Intergenic
1105695379 13:22883523-22883545 GGAGAATTGCTTGAACCTGGAGG - Intergenic
1105803816 13:23937039-23937061 GGAGAACTGCTTGAACCTGAGGG + Intergenic
1105843069 13:24272263-24272285 GGAGCACCGCTCAGAGCTGGAGG - Intronic
1106002507 13:25737587-25737609 GGAGGACTGCTTGAGCCTGGAGG - Intronic
1106233743 13:27843581-27843603 GGAGGATTGCTTAAGCCTGGCGG - Intergenic
1106507322 13:30382540-30382562 GGAGAATTGCTTAAACCTGGAGG + Intergenic
1106511552 13:30417589-30417611 GGAGAATTGCTTGAACCTGGAGG + Intergenic
1106825063 13:33511220-33511242 GGAGAATTGCTTGAACCTGGGGG + Intergenic
1106939977 13:34767646-34767668 GGAGGATTGCTTGAACCTGGAGG + Intergenic
1107305763 13:39016978-39017000 GCAGCACTGCTGCCATCTGGAGG + Intronic
1107502337 13:40993362-40993384 GGTGCACTGCCCACACCTGCAGG - Intronic
1107519671 13:41167322-41167344 GGAGAATTGCTGAAACCTGGCGG + Intergenic
1107908709 13:45085344-45085366 GGAGAATTGCTTGAACCTGGGGG + Intergenic
1108022050 13:46137447-46137469 GGAGAATTGCTTGAACCTGGCGG + Intronic
1110423869 13:75343605-75343627 GGAGAATTGCTTGAACCTGGAGG - Intronic
1111166778 13:84468050-84468072 GGAGAATTGCTTGAACCTGGAGG + Intergenic
1111197758 13:84895991-84896013 GGAGAACTGCTTGAACATGGAGG - Intergenic
1112473325 13:99709000-99709022 GGAGAACTGCTTGAACCAGGGGG + Intronic
1112591599 13:100768271-100768293 GGAGAACTGCTTGAACCTGGAGG + Intergenic
1112747356 13:102541512-102541534 GGAGGACTGCTTGAGCCTGGGGG + Intergenic
1113183616 13:107660342-107660364 GGAGAATTGCTTGAACCTGGGGG + Intronic
1113186036 13:107686482-107686504 GGAGAATTGCTTGAACCTGGAGG - Intronic
1113926529 13:113944671-113944693 GGAGGACTTGTCACACCTGGAGG - Intergenic
1113926572 13:113944869-113944891 GGAGGACTTGTCACACCTGGAGG - Intergenic
1113926606 13:113945027-113945049 GGAGGACTTGTCACACCTGGAGG - Intergenic
1114296897 14:21338005-21338027 GGAGAATTGCTTGAACCTGGGGG - Intronic
1115200100 14:30843953-30843975 GGAGAATTGCTTGAACCTGGGGG - Intergenic
1115291776 14:31780151-31780173 GGAGAATTGCTTAAACCTGGGGG - Intronic
1115981048 14:39051875-39051897 GGAGGATTGCTTGAACCTGGAGG + Intronic
1116813901 14:49566206-49566228 GGAGAATTGCTTGAACCTGGAGG + Intergenic
1117821626 14:59656412-59656434 GCAGCACTGCAGCCACCTGGAGG - Intronic
1118387062 14:65264829-65264851 GGAGAATTGCTTGAACCTGGGGG - Intergenic
1118718334 14:68576079-68576101 GGACCACTGCTCTCACCAGGTGG - Intronic
1118845854 14:69547491-69547513 AGAGAATTGCTTAAACCTGGAGG + Intergenic
1119167740 14:72509272-72509294 GGAGCATTGCTTGAACCCGGCGG + Intronic
1119179197 14:72593473-72593495 GGAGAATTGCTTGAACCTGGAGG - Intergenic
1119854160 14:77886814-77886836 GGAGAATTGCTTGAACCTGGGGG + Intronic
1119891836 14:78188573-78188595 GGAGCTCTGCCTACAGATGGGGG + Intergenic
1120132934 14:80828211-80828233 GGAGAATTGCTTGAACCTGGGGG - Intronic
1120168579 14:81226192-81226214 GGAGAACTGCTTGAACCTGTTGG - Intergenic
1120878043 14:89392729-89392751 GGAGAATTGCTTGAACCTGGGGG - Intronic
1120949002 14:90023760-90023782 GGAGGACTGCTTGAGCCTGGTGG - Intronic
1121225878 14:92321924-92321946 GGAGCACTTCTCACACGTGAAGG + Intergenic
1121765772 14:96484131-96484153 GGAGGATTGCTTAAGCCTGGAGG + Intronic
1121783031 14:96634693-96634715 GGAGCACTGCCAACCGCTGGTGG - Intergenic
1121944487 14:98106127-98106149 GGAGAATTGCTTGAACCTGGAGG - Intergenic
1122045717 14:99021742-99021764 GGTGCACTGCTAACATCTAGTGG - Intergenic
1122061423 14:99139066-99139088 TGAGCACGTCTTAGACCTGGAGG + Intergenic
1122162849 14:99798481-99798503 GGAGAACTGCTTGAACCTAGGGG - Intronic
1122619616 14:103047811-103047833 GGAGAACTGCTTGAACCGGGAGG + Intronic
1123222748 14:106872341-106872363 GGAGAACGGCTTGAACCTGGGGG - Intergenic
1202880166 14_KI270722v1_random:50483-50505 GGAGAATTGCTTGAACCTGGGGG + Intergenic
1123662679 15:22578253-22578275 GGAGAACTGCTTAAACCCGGGGG - Intergenic
1123722495 15:23071888-23071910 AGAGAATTGCTTAAACCTGGAGG + Intergenic
1123825694 15:24079858-24079880 GGAGAATTGCTTGAACCTGGGGG - Intergenic
1123905155 15:24913550-24913572 GGAGAATCGCTTAAACCTGGTGG + Intronic
1124261606 15:28197659-28197681 GGAGAATTCCTTAAACCTGGGGG + Intronic
1124316480 15:28672557-28672579 GGAGAACTGCTTAAACCCGGGGG - Intergenic
1124356503 15:28999055-28999077 GGAGAATTGCTTGAACCTGGGGG + Intronic
1124927204 15:34082303-34082325 GGAGAATTGCTTGAACCTGGGGG - Intergenic
1125026880 15:35039622-35039644 AGAGAATTGCTTAAACCTGGAGG - Intergenic
1125628822 15:41131259-41131281 GGAGAATTGCTTGAACCTGGGGG + Intergenic
1125680192 15:41525744-41525766 AGAGAATTGCTTAAACCTGGAGG - Intronic
1125832027 15:42723794-42723816 GGAGACCTGCTTGAACCTGGAGG - Exonic
1125887753 15:43241249-43241271 TGAGCTCTGCTTACGCCAGGAGG + Intronic
1126080149 15:44952543-44952565 GGAGAACTGCTTGAACCAGGGGG + Intergenic
1126111700 15:45178945-45178967 GGACCATAGCTTACACCAGGTGG + Intronic
1126354669 15:47782776-47782798 GGAGAATTGCTTGAACCTGGGGG - Intergenic
1126444478 15:48727129-48727151 GGAGAATTGCTTGAACCTGGGGG - Intronic
1126804381 15:52331594-52331616 GAAGCACTACTGACACCTCGTGG - Intronic
1126936297 15:53712502-53712524 GGAGAACTGCTTGAACCTGGGGG + Intronic
1126953748 15:53911230-53911252 AGTGCCCTGCTTGCACCTGGAGG - Intergenic
1127087564 15:55438692-55438714 GAAGAACTGCTTGAACCTGGCGG + Intronic
1127111028 15:55670808-55670830 GGAGAATTGCTTGAACCTGGAGG + Intronic
1127328521 15:57917452-57917474 GGAGAATTGCTTAAACCTGGGGG + Intergenic
1127457515 15:59168453-59168475 GGAGGATTGCTTGAACCTGGAGG + Intronic
1127503097 15:59572820-59572842 GGAGAATTGCTTGAACCTGGAGG + Intergenic
1127798823 15:62460353-62460375 GGAGAATTGCTTGAACCTGGAGG - Intronic
1127985765 15:64069256-64069278 AGAGAATTGCTTAAACCTGGGGG - Intronic
1128204593 15:65839360-65839382 GGAGAACTGCTTGAACCGGGAGG + Intronic
1128484864 15:68075174-68075196 GGAGAATTGCTTGAACCTGGGGG - Intronic
1128531917 15:68459128-68459150 GGATTAGTGCTTACCCCTGGAGG + Intergenic
1129008254 15:72392995-72393017 GGAGAAACGCTTGCACCTGGGGG - Intergenic
1129150992 15:73687662-73687684 GGAGCACTGGTCAGAACTGGAGG - Intronic
1129246045 15:74279625-74279647 GGAGAACTGCTTGAACCCGGGGG - Intronic
1129864648 15:78896399-78896421 GGAGAATTGCTTGAACCTGGAGG - Intronic
1130146828 15:81280833-81280855 GGAGCCCTGGTTACAGCTGTTGG - Intronic
1130349602 15:83079323-83079345 GGAGAATTGCTTTAACCTGGGGG + Intergenic
1130661746 15:85836374-85836396 GGAGAATTGCTTGAACCTGGAGG + Intergenic
1131495842 15:92910095-92910117 GGAGAACTGCTTGAGCCTGGAGG - Intronic
1132126575 15:99231881-99231903 GGAGAATTGCTTGAACCTGGGGG - Intronic
1132718296 16:1303252-1303274 GGAGAACTGCTTGAACCGGGGGG - Intergenic
1132856387 16:2046879-2046901 GGAGAACTGCTTGAACCTGGGGG + Intronic
1132893891 16:2218455-2218477 GGAGAATTGCTTGAACCTGGTGG - Intergenic
1133180505 16:4050621-4050643 GGAGAACTGCTTGAACCGGGAGG + Intronic
1133488061 16:6239586-6239608 GGAGAACTGCTTGAACCAGGTGG - Intronic
1133772463 16:8875253-8875275 GGAGGACTGCTTAAACCTGGAGG - Intergenic
1133886608 16:9834470-9834492 GGAGAATTGCTTGAACCTGGGGG - Intronic
1133952105 16:10404631-10404653 TGAGAACTGCTTAAACCTGGAGG - Intronic
1133954806 16:10432785-10432807 GGAGAATTGCTTGAACCTGGGGG + Intronic
1134006837 16:10823506-10823528 GGAGAATTGCTTGAACCTGGGGG + Intergenic
1134013722 16:10874072-10874094 GGAGAATTGCTTGAACCTGGGGG - Intergenic
1134103096 16:11466477-11466499 GGAGAATTGCTTGAACCTGGTGG - Intronic
1134254727 16:12601642-12601664 TGAGCATTGCTCACACCTGCTGG - Intergenic
1134277779 16:12792040-12792062 GGAGAATTGCTTGAACCTGGGGG - Intronic
1134285873 16:12861693-12861715 GGAGAATTGCTTAAACTTGGAGG + Intergenic
1134823594 16:17266639-17266661 GGTGCACTGCTCACACATGAGGG + Intronic
1134996694 16:18744713-18744735 GGAGAATTGCTTGAACCTGGGGG - Intergenic
1135052275 16:19202814-19202836 GGAGGATTGCTTGAACCTGGAGG - Intronic
1135133020 16:19868281-19868303 GGAGAATTGCTTGAACCTGGAGG + Intronic
1135453872 16:22580650-22580672 GGAGAACTGCTTGAACCTGGGGG + Intergenic
1135772224 16:25226346-25226368 GGAGAATTGCTTGAACCTGGGGG - Intronic
1136126681 16:28188165-28188187 GGAGGATTGCTTGAACCTGGGGG - Intronic
1136358371 16:29761411-29761433 GGAGAACTGCTTGAACCCGGGGG + Intergenic
1136508098 16:30719305-30719327 GGAGAATTGCTTAAACCTGGAGG - Intronic
1138169992 16:54840064-54840086 GGAGAATTGCTTGAACCTGGGGG - Intergenic
1138238987 16:55411351-55411373 GAAGCACTGCTGGGACCTGGAGG - Intronic
1138458969 16:57136821-57136843 GGAGAATTGCTTGAACCTGGGGG + Intronic
1138637502 16:58352762-58352784 GGAGAATTGCTTGAACCTGGGGG - Intronic
1138643893 16:58408543-58408565 GGAGAACTGCTTGAACCCGGAGG - Intergenic
1138646728 16:58431084-58431106 GGAGAATTGCTTGAACCTGGGGG - Intergenic
1139613838 16:68077160-68077182 AGAGAACTGCTTAAACCTGGAGG + Intronic
1139732604 16:68959494-68959516 GGAGAATTGCTTGAACCTGGGGG + Intronic
1139825464 16:69753894-69753916 GGAGAATTGCTTGAACCTGGAGG - Intronic
1139839068 16:69863546-69863568 GGAGAATTGCTTGAACCTGGTGG + Intronic
1140499151 16:75418160-75418182 GGAGAATTGCTTGAACCTGGGGG + Intronic
1140679091 16:77366465-77366487 GGAGAATTGCTTGAACCTGGTGG + Intronic
1141134829 16:81458400-81458422 GGTGCCCTGCTTACCACTGGGGG - Intronic
1141330136 16:83103334-83103356 GGAGAATTGCTTGAACCTGGAGG - Intronic
1141485613 16:84338023-84338045 GGAGAATTGCTTGAACCTGGAGG - Intergenic
1141537580 16:84693276-84693298 GGAGGATTGCTTGAACCTGGGGG - Intergenic
1141580190 16:84992380-84992402 GGAGAACTGCTTGAACCCGGGGG + Intronic
1141586055 16:85034287-85034309 GGAGAATTGCTTGAACCTGGGGG + Intronic
1141878756 16:86844413-86844435 AGAGAATTGCTTAAACCTGGAGG - Intergenic
1142064123 16:88050776-88050798 GGAGGATTGCTTGAACCTGGAGG - Intronic
1203052121 16_KI270728v1_random:885342-885364 GGAGAATTGCTTGAACCTGGGGG - Intergenic
1142587533 17:983047-983069 AGAGAATTGCTTAAACCTGGAGG - Intergenic
1142657886 17:1406295-1406317 GGAGAATTGCTTGAACCTGGAGG + Intergenic
1142668526 17:1476267-1476289 GGAGAATTGCTTGAACCTGGGGG - Intronic
1142700195 17:1655046-1655068 GGAGAATTGCTTGAACCTGGGGG - Intronic
1142990938 17:3730360-3730382 AGAGAACTGCTTGAACCTGGAGG + Intronic
1143081989 17:4388631-4388653 GGAGAATTGCTTGAACCTGGAGG + Intergenic
1143853136 17:9827869-9827891 GGAGAATTGCTTGAACCTGGAGG + Intronic
1143955381 17:10663970-10663992 GGAGAATTGCTTGAACCTGGGGG + Intergenic
1144016503 17:11201195-11201217 GGAGAATTGCTTGAACCTGGAGG - Intergenic
1144261702 17:13527997-13528019 GAGGCACTGCTTATTCCTGGGGG - Intronic
1144306548 17:13973762-13973784 GGAGAATTGCTTGAACCTGGTGG - Intergenic
1144688645 17:17244127-17244149 GGAGAATTGCTTAAACCAGGAGG + Intergenic
1144946777 17:18973388-18973410 GGAACACTGCTGACCCCAGGTGG + Intronic
1145220353 17:21083596-21083618 GGAGAATTGCTTGAACCTGGGGG - Intergenic
1145256013 17:21322864-21322886 GGAGAACTGCTTGAACCCGGAGG + Intergenic
1145862276 17:28221099-28221121 GGAGAATTGCTTGAACCTGGGGG - Intergenic
1145986565 17:29051029-29051051 GGAGAATTGCTTACACCCGGGGG + Intronic
1146242949 17:31247103-31247125 GGAGAATTGCTTGAACCTGGAGG + Intronic
1146330252 17:31921015-31921037 GGAGAATTGCTTGAACCTGGAGG + Intergenic
1146367375 17:32239251-32239273 GGAGAATTGCTTGAACCTGGAGG + Intronic
1146959522 17:36961763-36961785 GGAGAATTGCTTAAACCCGGCGG - Intronic
1147109523 17:38251587-38251609 GGAGAACTGCCTGAACCTGGGGG + Intergenic
1147209859 17:38866621-38866643 GGAGAATTGCTTGAACCTGGGGG + Intergenic
1147247460 17:39131796-39131818 GGAGCACTGCTTGCCCCCTGTGG + Intronic
1147260079 17:39204855-39204877 GGAGAACTGCTTGAACCTGGAGG - Intergenic
1147681011 17:42245611-42245633 GGAGAATTGCTTGAACCTGGGGG - Intronic
1147806941 17:43138558-43138580 GGAGCCCTACTTATACTTGGAGG - Intergenic
1148115724 17:45173509-45173531 GGAGAATTGCTTGAACCTGGGGG - Intergenic
1148181210 17:45606275-45606297 GGAGAATTGCTTGAACCTGGGGG + Intergenic
1148261393 17:46186816-46186838 GGAGAATTGCTTGAACCTGGAGG - Intronic
1148374480 17:47130268-47130290 GGAGAATTGCTTGAACCTGGAGG + Intronic
1148419927 17:47536482-47536504 GGAGAATTGCTTGAACCTGGGGG - Intronic
1148652257 17:49258818-49258840 GGAGAACTGCTTGAACCCGGAGG - Intergenic
1148707619 17:49649444-49649466 GGAGAATTGCTTAAACCGGGAGG + Intronic
1148716673 17:49720804-49720826 AGAGAACTGCTTGAACCTGGTGG - Intronic
1148853585 17:50566606-50566628 GGTGAACTGCTTATAACTGGGGG - Intronic
1149259052 17:54859062-54859084 GGAGAATCGCTTAAACCTGGGGG + Intergenic
1149409557 17:56391516-56391538 AGAGAATTGCTTAAACCTGGAGG - Intronic
1149493666 17:57102987-57103009 GGAGAACTGCATGAACCTGGAGG + Intronic
1149540342 17:57463573-57463595 TGAGCACTGCCTTCACATGGGGG + Intronic
1149766596 17:59284012-59284034 GGAGAATTGCTTGAACCTGGAGG + Intergenic
1149769997 17:59313193-59313215 GGAGAATTGCTTGAACCTGGAGG - Intergenic
1149782917 17:59412216-59412238 GGAGAATTGCTTGAACCTGGGGG + Intergenic
1149791295 17:59479917-59479939 GGAGAATTGCTTGAACCTGGAGG - Intergenic
1149946208 17:60930544-60930566 GGAGAATTGCTTGAACCTGGAGG - Intronic
1150074285 17:62179463-62179485 GGAGAATTGCTTGAACCTGGTGG + Intergenic
1150430467 17:65111767-65111789 GGAGAATTGCTTGAACCTGGGGG - Intergenic
1150676435 17:67248245-67248267 GGAGAATTGCTTGAACCTGGGGG + Intergenic
1150798763 17:68262064-68262086 GGAGAATTGCTTGAACCTGGAGG + Intronic
1150821448 17:68437462-68437484 GGAGAATTGCTTAAACCTGGAGG + Intronic
1151259501 17:72905504-72905526 GAAGAACTGCTTGAACCTGGGGG + Intronic
1151286790 17:73117828-73117850 GGAGAATTGCTTAAACCTAGGGG + Intergenic
1151324512 17:73370646-73370668 GGAGGATTGCTTGAACCTGGAGG - Intronic
1151341659 17:73475240-73475262 GGAGAATTGCTTGAACCTGGTGG - Intronic
1151844812 17:76645065-76645087 GGCTCACTGTTCACACCTGGCGG + Intergenic
1151893624 17:76965753-76965775 GGAGAATTGCTTGGACCTGGGGG + Intergenic
1151986324 17:77546491-77546513 GGAGGATTGCTTGAACCTGGGGG - Intergenic
1152024460 17:77799590-77799612 GGAGAATTGCTTGAACCTGGGGG + Intergenic
1152160526 17:78665741-78665763 GCAGCACTGCTTTCATCTCGGGG + Intergenic
1152446770 17:80349365-80349387 GGAGAATTGCTGACATCTGGGGG + Intronic
1152475590 17:80516010-80516032 AGAGAATTGCTTAAACCTGGAGG + Intergenic
1152477063 17:80525434-80525456 GGAGCACTGCCTCCTCCTGGTGG - Intergenic
1153010625 18:535592-535614 GGAGAATTGCTTGAACCTGGGGG + Intergenic
1153033170 18:734186-734208 GGAGAATTGCTTGAACCTGGGGG + Intronic
1153870276 18:9312398-9312420 GGAGAATTGCTTGAACCTGGAGG + Intergenic
1153915523 18:9741283-9741305 GGAGAATTGCTTGAACCTGGTGG + Intronic
1154180066 18:12128973-12128995 GGAGAATTGCTTGAACCTGGCGG + Intronic
1154265899 18:12878577-12878599 GTAGAACTGCTTGAACCTGGGGG + Intronic
1154287789 18:13076313-13076335 AGAGAACTGCTTGAACCTGGGGG - Intronic
1154930545 18:20990601-20990623 GGAGAATTGCTTGAACCTGGAGG + Intronic
1155007936 18:21745795-21745817 GGAGAATTGCTTGAACCTGGGGG - Intronic
1155214414 18:23630334-23630356 GGAGAATCGCTTGCACCTGGAGG + Intronic
1155301280 18:24431790-24431812 GGAGAACTGCTTGAACCTGAGGG - Intronic
1156029261 18:32693216-32693238 GGAGAACTGGTTACACCTTGCGG - Intronic
1156259290 18:35429822-35429844 GGAGAATTGCTTGAACCTGGGGG - Intergenic
1157249557 18:46082591-46082613 GGAGAATTGCTTGAACCTGGAGG + Exonic
1157446335 18:47749265-47749287 TGAGCTCTGCTGACCCCTGGCGG + Intergenic
1158298389 18:56024699-56024721 GGAGAATTGCTTGAACCTGGGGG + Intergenic
1158340022 18:56455736-56455758 GGAGCATTGCTTGAACCTGGAGG + Intergenic
1158475334 18:57774504-57774526 GGAGAACTGCTTGAACCTGGAGG + Intronic
1158479744 18:57811110-57811132 GGAGAATTGCTTGAACCTGGTGG - Intergenic
1158972456 18:62680868-62680890 GGAGGATTGCTTAATCCTGGAGG - Intergenic
1159138435 18:64364173-64364195 GGAGGATTGCTTACATCTAGGGG + Intergenic
1159154985 18:64571985-64572007 GGAGAATTGCTTGAACCTGGGGG - Intergenic
1159846251 18:73464415-73464437 GGAGAACTGCTTGAACCTGGAGG - Intergenic
1160054819 18:75469161-75469183 GGAGAATTGCTTGAACCTGGTGG - Intergenic
1160116145 18:76081457-76081479 GGAGCACAACTTCCTCCTGGAGG - Intergenic
1160977085 19:1798059-1798081 GGAGAACTGCTTGAACCCGGAGG - Intronic
1161097432 19:2400881-2400903 GGAGAATTGCTTAAACCTGGTGG + Intronic
1161116470 19:2499701-2499723 GGAGAATTGCTTGAACCTGGGGG - Intergenic
1161346950 19:3772938-3772960 GGAGAATTGCTTGAACCTGGTGG + Intergenic
1161365023 19:3873759-3873781 GGAGAACTGCTTGAACCTGGAGG + Intergenic
1161439755 19:4284209-4284231 GGAGAATTGCTTGAACCTGGAGG + Intronic
1161569199 19:5021053-5021075 GGAGAATTGCTTGAACCTGGGGG + Intronic
1161708429 19:5833396-5833418 GGAGAATTGCTTGAACCTGGGGG + Intronic
1161758099 19:6149595-6149617 GGAGAATTGCTTGAACCTGGAGG - Intronic
1161833158 19:6624710-6624732 GGAGAACTGCTTGAACCTGGAGG + Intergenic
1162112736 19:8409194-8409216 GGAGAATTGCTTGAACCTGGGGG + Intronic
1162122446 19:8479864-8479886 AGAGAACAGCTTAAACCTGGAGG - Intronic
1162271636 19:9620948-9620970 GGAGAACTGCTTGACCCTGGAGG + Intronic
1162528001 19:11217940-11217962 GGAGAATTGCTTGAACCTGGGGG - Intronic
1162606449 19:11711978-11712000 GGAGAATTGCTTGAACCTGGTGG - Intergenic
1162642278 19:12021068-12021090 GGAGAATTGCTTGAACCTGGAGG - Intronic
1162714705 19:12622800-12622822 AGAGAATTGCTTAAACCTGGAGG + Intronic
1163129161 19:15261390-15261412 GGAGAACTGCTTGAACCAGGAGG + Intronic
1163264769 19:16213583-16213605 GGAGAATTGCTTGAACCTGGGGG - Intronic
1163373855 19:16918083-16918105 GGAGAATTGCTTGAACCTGGAGG - Intronic
1163428644 19:17253378-17253400 AGAGAATTGCTTAAACCTGGAGG - Intronic
1163494949 19:17640967-17640989 GGAGAATTGCTTGAACCTGGGGG - Intronic
1163725025 19:18918097-18918119 GGAGAATTGCTTGAACCTGGGGG + Intronic
1164861541 19:31565748-31565770 GGAGCACAGCCTGCAACTGGCGG - Intergenic
1165012844 19:32861236-32861258 GGAGAATTGCTTGAACCTGGGGG + Intronic
1165154375 19:33778234-33778256 AGAGCGCTGCTGCCACCTGGCGG - Intergenic
1165175892 19:33929501-33929523 GGATAACTGATTAGACCTGGAGG - Intergenic
1165406968 19:35636987-35637009 GGAGCTCTGCTGGCACCTGGAGG - Intronic
1165468734 19:35990593-35990615 GGAGAATTGCTTGAACCTGGAGG + Intergenic
1165531259 19:36403526-36403548 AGAGAACTGCTTAAACCTGGAGG + Intronic
1165718099 19:38059864-38059886 GGAGAATTGCTTGAACCTGGAGG - Intronic
1166086994 19:40482868-40482890 GGAGAATTGCTTGAACCTGGGGG + Intronic
1166091450 19:40512031-40512053 GGAGAATCGCTTAAACCTGGAGG + Intronic
1166385971 19:42381308-42381330 GGAGAATTGCTTGAACCTGGAGG + Intergenic
1166453515 19:42920496-42920518 GGAGCACTCAGCACACCTGGAGG - Intronic
1166502305 19:43350920-43350942 GGAGAATTGCTTGAACCTGGAGG + Intergenic
1166534612 19:43564695-43564717 GGAGAATTGCTTAAACCGGGGGG + Intronic
1166789039 19:45386724-45386746 GGAGAATTGCTTGAACCTGGGGG - Intronic
1167039287 19:47013137-47013159 GGCGCTCTGCTGACCCCTGGTGG - Intergenic
1167232289 19:48292576-48292598 GGAGGATTGCTTGAACCTGGGGG - Intergenic
1167339160 19:48904612-48904634 GGAGAACTGCTTGAACCTGCGGG - Intronic
1168090803 19:54082065-54082087 GGAGAACCGCTTGAACCTGGGGG - Intergenic
1168241761 19:55092311-55092333 GCAGCTCTGCATACAGCTGGGGG + Exonic
1168552186 19:57305607-57305629 GGAGGACTGCTTAGGCCAGGAGG - Intergenic
1168579323 19:57540667-57540689 GGAGAATTGCTTGAACCTGGGGG + Exonic
1202655777 1_KI270708v1_random:19575-19597 GGAGAATTGCTTGAACCTGGGGG + Intergenic
925488515 2:4365096-4365118 GGAGAATTGCTTGAACCTGGGGG + Intergenic
925895109 2:8465222-8465244 GGAGAATCGCTTAAACCTGGAGG + Intergenic
925979456 2:9165085-9165107 GGAGAATTGCTTGAACCTGGGGG + Intergenic
926017861 2:9470130-9470152 GGAGAATTGCTTAAACCAGGAGG + Intronic
926106339 2:10154384-10154406 GGAGAATTGCTTGAACCTGGTGG + Intronic
926145024 2:10391838-10391860 AGAGAACTGCTTAAACCTGGAGG - Intronic
926167121 2:10528227-10528249 GGAGAATTGCTTGAACCTGGAGG - Intergenic
926168382 2:10535732-10535754 CGAGCACTGCCTGGACCTGGTGG - Intergenic
926429417 2:12770823-12770845 AGTGCATTGCTTTCACCTGGAGG + Intergenic
926682844 2:15676991-15677013 GGAGAATTGCTTGAACCTGGAGG + Intergenic
927126384 2:20015367-20015389 GGAGGATTGCTTGAACCTGGAGG - Intergenic
927790571 2:26006332-26006354 GGAGAATTGCTTGAACCTGGGGG - Intergenic
928201235 2:29249014-29249036 GGCACAATGCTTACACGTGGTGG - Intronic
928309234 2:30195880-30195902 GGAGAATTGCTTGAACCTGGAGG - Intergenic
928401370 2:30980980-30981002 GGAGAACCGCTTGAACCTGGGGG + Intronic
928560422 2:32478244-32478266 GGAGAATTGCTTGAACCTGGGGG + Intronic
928872037 2:35991368-35991390 GGAGAATTGCTTGAACCTGGGGG - Intergenic
929389737 2:41456589-41456611 GGAGAATTGCTTGAACCTGGGGG - Intergenic
929525689 2:42701005-42701027 GGAGGATTGCTTGAACCTGGGGG + Intronic
929803489 2:45124343-45124365 GGAGAACCGCTTGAACCTGGAGG - Intergenic
930016365 2:46973509-46973531 GGTGAACTGTTTCCACCTGGAGG + Intronic
930619351 2:53627628-53627650 GGAGAATTGCTTGAACCTGGGGG + Intronic
931062739 2:58549108-58549130 GGAGAATTGCTTGAACCTGGGGG + Intergenic
931151129 2:59574581-59574603 GGAGAATTGCTTGAACCTGGAGG + Intergenic
931254921 2:60562405-60562427 GGAGAATTGCTTGAACCTGGAGG - Intergenic
931606853 2:64061420-64061442 AGAGAATTGCTTAAACCTGGAGG - Intergenic
931717147 2:65038114-65038136 GGAGAATTGCTTGAACCTGGAGG + Intergenic
931999216 2:67868721-67868743 GGAGAATTGCTTGAACCTGGGGG - Intergenic
932016666 2:68035052-68035074 GGAGAACTGCTTGAACCGGGAGG + Intergenic
932036994 2:68255447-68255469 GGAGAATTGCTTGAACCTGGGGG + Intronic
932245818 2:70195400-70195422 GGAGAACCGCTTGAACCTGGGGG - Intronic
932379063 2:71265382-71265404 GGAGAATTGCTTGAACCTGGAGG - Intergenic
932637536 2:73405000-73405022 GGAGGACTGCTTGAGCCTGGAGG - Intronic
933090613 2:78111602-78111624 GGTGCCCTGCTTGCACCTGGAGG + Intergenic
933090634 2:78111758-78111780 GGTGCCCTGCCTGCACCTGGAGG + Intergenic
933188309 2:79303489-79303511 GGTGCACTTCTTAATCCTGGTGG + Intronic
933729906 2:85448618-85448640 GTAGCACTGCTTGCCCCTGGAGG - Intergenic
933738995 2:85518213-85518235 GGAGAATTGCTTAAACCTGGGGG - Intergenic
933849159 2:86351842-86351864 GGAGGACTGCTTAAGCCTAGAGG - Intergenic
934890613 2:98065565-98065587 GGAGAATTGCTTGAACCTGGAGG - Intergenic
935606079 2:104973552-104973574 GGAGAATTGCTTGAACCTGGGGG - Intergenic
935732546 2:106076225-106076247 GGAGAACCGCTTGAACCTGGTGG + Intronic
937188993 2:120074917-120074939 TGAGAACTGCTTGAACCTGGGGG - Intronic
937677270 2:124605723-124605745 GGAGAATTGCTTGGACCTGGCGG + Intronic
937784735 2:125883478-125883500 GGAGGATTGCTTGAACCTGGGGG - Intergenic
937897045 2:126985373-126985395 GGAGAATTGCTTGAACCTGGGGG - Intergenic
938046959 2:128130169-128130191 GGAGAATTGCTTCAACCTGGGGG + Intronic
938292659 2:130158405-130158427 GGAGAATTGCTTGAACCTGGAGG - Intronic
938889701 2:135692001-135692023 GGAGAATTGCTTGAACCTGGAGG - Intronic
940212797 2:151273611-151273633 GGAGAATTGCTTGAACCTGGGGG - Intronic
940343056 2:152601389-152601411 GGAGAATTGCTTGAACCTGGGGG - Intronic
940426071 2:153533340-153533362 GGAGAATTGCTTGAACCTGGGGG - Intergenic
940524986 2:154801715-154801737 GGAGAACAGCTTGAACCTGGAGG - Intronic
940834741 2:158508272-158508294 GGAGAATTGCTTGAACCTGGAGG + Intronic
940987450 2:160062994-160063016 GGAGCACTGGAGACACCTGAGGG + Intergenic
941275429 2:163484964-163484986 GGAGAATTGCTTGAACCTGGGGG - Intergenic
941397377 2:164990369-164990391 GGAGAATTGCTTGAACCTGGGGG + Intergenic
941460723 2:165768883-165768905 GGAGAATTGCTTGAACCTGGGGG - Intronic
941774847 2:169381907-169381929 GGAGGACTGCTTGAGCCTGGTGG + Intergenic
942105177 2:172626701-172626723 GGAGGATTGCTTGAACCTGGCGG + Intergenic
942176905 2:173343177-173343199 GGAGAATTGCTTGAACCTGGGGG + Intergenic
943430201 2:187790153-187790175 GGAGAACTGCTTAAGCCAGGAGG + Intergenic
943889446 2:193268337-193268359 GGAGCATTGCTTGAACCTGGGGG - Intergenic
943973428 2:194440661-194440683 GGAGAACTGCTTGAACCTGGAGG - Intergenic
944150903 2:196557302-196557324 GGAGAATTGCTTGAACCTGGGGG + Intronic
944480999 2:200157813-200157835 AGAGAACTGCTTAAACCTGGAGG + Intergenic
945850750 2:215003756-215003778 GGAGAATTGCTTAAACCTGGGGG - Intronic
946244834 2:218381398-218381420 GGAGAATTGCTTAAACATGGAGG + Intergenic
946707124 2:222469273-222469295 AGAGAATTGCTTAAACCTGGAGG - Intronic
946730683 2:222706380-222706402 GGAGAATTGCTTGAACCTGGGGG + Intronic
946830444 2:223723139-223723161 GGAGAATTGCTTAACCCTGGAGG + Intergenic
947331208 2:229031463-229031485 GGAGAACTGCTTGAACCTGAAGG + Intronic
947737156 2:232461591-232461613 GGAGAATTGCTTGAACCTGGAGG + Intergenic
947832207 2:233149519-233149541 GGAGCCCTCCCTATACCTGGGGG - Intronic
947873924 2:233455757-233455779 GGAGCCATGCTGACACCTGAGGG + Intronic
948441308 2:237991953-237991975 GGAGAACTGCTTGAACCCGGGGG - Intronic
948453847 2:238095110-238095132 GGAGAATTGCTTGAACCTGGAGG + Intronic
948520889 2:238536873-238536895 GGTGCAGTGCTTACACCTCAGGG + Intergenic
948521611 2:238542497-238542519 GGTGCAGTGCTCACACCTCGGGG + Intergenic
948522018 2:238545655-238545677 GGTGCAGTGCTCACACCTCGGGG + Intergenic
1169124617 20:3118380-3118402 GGAGAATTGCTTAGACCAGGAGG + Intronic
1169225465 20:3853876-3853898 GGAGAATTGCTTGAACCTGGGGG - Intronic
1169686555 20:8280243-8280265 GGAGGATTGCTTGAACCTGGAGG + Intronic
1169688212 20:8300877-8300899 AGAGTGCTGCTTACACCTGCAGG + Intronic
1169978778 20:11360427-11360449 GGAGAACTGCTTGAACCCGGTGG - Intergenic
1170192551 20:13658451-13658473 GGAGAATTGCTTGAACCTGGGGG + Intergenic
1170503214 20:16996159-16996181 GGAGCACAGCTAACTTCTGGAGG + Intergenic
1170532769 20:17310908-17310930 AGAGAATTGCTTAAACCTGGAGG + Intronic
1170608414 20:17891356-17891378 GGAGAATTGCTTGAACCTGGAGG + Intergenic
1170657492 20:18303135-18303157 GGAGAATTGCTTGAACCTGGGGG - Intronic
1170684591 20:18557840-18557862 GGAGAATTGCTTGAACCTGGAGG - Intronic
1170939920 20:20840311-20840333 GGAGAATTGCTTGAACCTGGTGG - Intergenic
1171368563 20:24645167-24645189 GGTGCACTGCTCTCTCCTGGTGG + Intronic
1171949456 20:31407866-31407888 GGAGAACTGCTTGAACCCGGGGG - Intronic
1171983972 20:31646505-31646527 GGAGAATTGCTTGAACCTGGGGG + Intergenic
1171998239 20:31750246-31750268 GGAGAATTGCTTGAACCTGGGGG - Intronic
1172070597 20:32254109-32254131 GGAGAATTGCTTGAACCTGGAGG + Intergenic
1172394332 20:34589441-34589463 GGAGAATTGCTTGAACCTGGAGG - Intronic
1172535164 20:35667228-35667250 GGAGAATTGCTTGAACCTGGAGG - Intronic
1172874319 20:38155013-38155035 GGAGGATTGCTTGAACCTGGTGG + Intronic
1173149834 20:40557549-40557571 GCAGCCCTGCTGACACCTTGAGG - Intergenic
1173182475 20:40815469-40815491 GGAGCCCAGCTTCCACCTGCAGG + Intergenic
1173202742 20:40966224-40966246 GGAGCTCTGCTGTTACCTGGTGG - Intergenic
1173384298 20:42573838-42573860 AGAGAAGTGCTTAAACCTGGAGG - Intronic
1173647171 20:44640575-44640597 GGAGAATTGCTTGAACCTGGGGG + Intronic
1173797046 20:45868890-45868912 GGAGAATTGCTTGCACCCGGAGG - Intronic
1173934728 20:46851513-46851535 GGAGAATTGCTTGAACCTGGAGG - Intergenic
1174005366 20:47406657-47406679 GGAGAATTGCTTGAACCTGGAGG + Intergenic
1174173175 20:48629486-48629508 GGAGCTCTGCTACCGCCTGGGGG - Exonic
1174337360 20:49872575-49872597 AGAGAACTGCTTAAACCTGGAGG - Intronic
1174606058 20:51762403-51762425 GGAGAACTGCTTGAACCGGGAGG + Intronic
1174753176 20:53132399-53132421 GGAGAATTGCTTGAACCTGGAGG - Intronic
1174761676 20:53212781-53212803 GAAGTACTGCTTTCTCCTGGTGG + Intronic
1174826049 20:53769973-53769995 GGAGAATTGCTTGAACCTGGGGG - Intergenic
1174867347 20:54150422-54150444 GGAGAATTGCTTGAACCTGGGGG - Intergenic
1175649810 20:60709919-60709941 AGAGAATTGCTTAAACCTGGAGG + Intergenic
1176228070 20:64014564-64014586 GGAGAATTGCTTGAACCTGGCGG + Intronic
1176641477 21:9308018-9308040 GGAGAATTGCTTGAACCTGGGGG + Intergenic
1176858526 21:13988545-13988567 GGAGAATTGCTTGAACCTGGGGG + Intergenic
1176873221 21:14100832-14100854 GGAGAATTGCTTAAACCTGGGGG - Intergenic
1177169286 21:17637917-17637939 GGAGAATTGCTTGAACCTGGAGG + Intergenic
1177340941 21:19799426-19799448 GGAGAATTGCTTGAACCTGGGGG - Intergenic
1177415147 21:20783296-20783318 GGAGTTCTGCTTACACATGGAGG - Intergenic
1177652038 21:23969424-23969446 GGCGCACAGCTTGCACCTGGAGG + Intergenic
1178238955 21:30877112-30877134 GGAGAATTGCTTGAACCTGGAGG - Intergenic
1178348263 21:31850759-31850781 GGAGAATTGCTTGAACCTGGGGG + Intergenic
1178567589 21:33701975-33701997 GGAGAAGTGCTTGAACCTGGAGG + Intronic
1178878591 21:36431159-36431181 GGAGAATTGCTTGAACCTGGAGG - Intergenic
1179054354 21:37916985-37917007 TGAGCTTTGCTTGCACCTGGTGG + Intergenic
1179305892 21:40153753-40153775 GGAGCACTGGTATCCCCTGGAGG - Intronic
1180090633 21:45532172-45532194 GCAGCATTGCTAACACCTGGTGG - Intronic
1180213424 21:46309903-46309925 AGAGAATTGCTTAAACCTGGAGG + Intronic
1180350495 22:11797375-11797397 GGAGAATTGCTTGAACCTGGGGG + Intergenic
1180374776 22:12080789-12080811 GGAGAATTGCTTGAACCTGGGGG + Intergenic
1180652380 22:17388901-17388923 GGAGAACTGCTTGAACCCGGAGG - Intronic
1180739556 22:18043392-18043414 GGAGAACCGCTTGAACCTGGAGG + Intergenic
1180943051 22:19672527-19672549 GGAGAATTGCTTGAACCTGGAGG - Intergenic
1181169710 22:21001263-21001285 GGAGGACTGCTTTGAGCTGGTGG - Exonic
1181298212 22:21859385-21859407 GGAGAACTGCTTGAACCTGGGGG + Intronic
1181550322 22:23634844-23634866 GGAGAATTGCTTAAACCTGGGGG + Intergenic
1181679278 22:24480471-24480493 GGAGAATTGCTTGAACCTGGGGG + Intergenic
1181693797 22:24582808-24582830 GGAGAATTGCTTGAACCTGGTGG - Intronic
1181933404 22:26421484-26421506 GGAGAATTGCTTGAACCTGGAGG - Intergenic
1181960817 22:26620652-26620674 GGAGAATTGCTTGAACCTGGAGG - Intergenic
1182010930 22:27000076-27000098 GGAGAATTGCTTGAACCTGGGGG - Intergenic
1182025490 22:27114914-27114936 GGAGAATTGCTTGAACCTGGGGG + Intergenic
1182480176 22:30603470-30603492 GGAGAATTGCTTGAACCTGGGGG - Intronic
1182824730 22:33255026-33255048 GGAGAATTGCTTGAACCTGGGGG - Intronic
1182899711 22:33887645-33887667 GGAGAACTGCTTGAGCCTGGAGG + Intronic
1183317474 22:37144652-37144674 GGAGAATTGCTTGAACCTGGAGG + Intronic
1183693662 22:39406305-39406327 AGAGAATTGCTTAAACCTGGAGG + Intronic
1184157489 22:42677701-42677723 GGAGAATTGTTTAAACCTGGAGG + Intergenic
1184331223 22:43829099-43829121 GGAGCACTGCCACCAGCTGGTGG - Exonic
1184458969 22:44626395-44626417 GGGGCACTGCTGCCACCTAGTGG + Intergenic
1185292103 22:50032320-50032342 GGCGCACAGCTCACAGCTGGAGG + Intronic
1185355383 22:50366392-50366414 GGAGAACTGCTTGAACCCGGAGG - Intronic
949868150 3:8563671-8563693 GGAGCACTCTTTAGACATGGAGG + Intronic
949975668 3:9456381-9456403 GGAGAATTGCTTGAACCTGGAGG + Intronic
951477102 3:23118416-23118438 GGAGAATTGCTTGAACCTGGGGG + Intergenic
951730737 3:25807872-25807894 GGAGAATTGCTTAAACCGGGAGG + Intergenic
951866416 3:27313801-27313823 AGAGAATTGCTTAAACCTGGGGG - Intronic
951881817 3:27486920-27486942 GGAGAATTGCTTGAACCTGGAGG - Intergenic
952358417 3:32605754-32605776 GGAGAATTGCTTGAACCTGGGGG + Intergenic
952388661 3:32861265-32861287 GGAGAATTGCTTGAACCTGGAGG - Intronic
952443215 3:33354421-33354443 GGAGAATTGCTTGAACCTGGAGG + Intronic
952772045 3:37010628-37010650 GGAGAATTGCTTCAACCTGGAGG - Intronic
953100438 3:39820410-39820432 GAAGCACTGCTTACACATACTGG - Intronic
953730242 3:45441113-45441135 GGAGAATTGCTTGAACCTGGAGG - Intronic
953739239 3:45522648-45522670 GGAGGATTGCTTAAACCTGTAGG + Intronic
953947243 3:47160389-47160411 GGAGAATTGCTTGAACCTGGAGG - Intronic
953954132 3:47217537-47217559 GGAGAATTGCTTGAACCTGGAGG - Intergenic
953985131 3:47435957-47435979 GGAGGACTGCTTAAGCCTAGAGG + Intronic
953991672 3:47488698-47488720 GGAGACCTGCTTGAACCTGGGGG + Intergenic
954060082 3:48059887-48059909 GGAGAATTGCTTGAACCTGGAGG + Intronic
954069765 3:48134460-48134482 GGAGAATTGCTTGAACCTGGAGG - Intergenic
954237837 3:49270611-49270633 GGAGAATTGCTTGAACCTGGAGG - Exonic
954343092 3:49971352-49971374 GGAGAATTGCTTGAACCTGGGGG + Intronic
954560890 3:51555563-51555585 GGAGAATTGCTTGAACCTGGGGG + Intronic
954567459 3:51610547-51610569 AGAGAATTGCTTAAACCTGGAGG + Intronic
954813760 3:53264453-53264475 GGAGAATTGCTTGAACCTGGCGG + Intergenic
954834529 3:53454121-53454143 GGAGAATTGCTTGAACCTGGGGG - Intergenic
955048732 3:55388365-55388387 GGAGAACTGCTTGAACCAGGAGG - Intergenic
955121096 3:56059179-56059201 GGAGAATTGCTTGAACCTGGGGG - Intronic
955240303 3:57172054-57172076 GGAGAATTGCTTGAACCTGGGGG - Intergenic
955424490 3:58773463-58773485 GGAGGACTGCTTGAGCCTGGAGG + Intronic
955678138 3:61471119-61471141 GGAGAATTGCTTGAACCTGGGGG - Intergenic
955686127 3:61550168-61550190 GGAGAATTGCTTGAACCTGGGGG + Intergenic
955742464 3:62106591-62106613 GGAGGACTGCTAGAACCTGGGGG - Intronic
955908883 3:63839097-63839119 CGAGTACTGCTTGAACCTGGGGG + Intronic
956625889 3:71266338-71266360 GGAGAATTGCTTAAACCTGGGGG - Intronic
956719716 3:72107152-72107174 GGAGGATTGCTTGAACCTGGAGG - Intergenic
956783137 3:72620271-72620293 TCAGGACTGCTTCCACCTGGAGG - Intergenic
956821689 3:72959723-72959745 GGAGAATTGCTTGAACCTGGGGG - Intronic
956914770 3:73859798-73859820 GGAGAATTGCTTGAACCTGGGGG - Intergenic
957001615 3:74893149-74893171 AGAGCACTGCTTAAACCTGGAGG + Intergenic
957852187 3:85822491-85822513 GAAGAATTGCTTGCACCTGGGGG + Intronic
958158764 3:89789644-89789666 GGAGAATTGCTTGAACCTGGCGG - Intergenic
958431074 3:94041963-94041985 AGAGAATTGCTTAAACCTGGAGG + Intronic
958803162 3:98779646-98779668 GAAACACAGCTTTCACCTGGGGG + Intronic
959008862 3:101050839-101050861 GGAGAATTGCTTGAACCTGGAGG + Intergenic
959060248 3:101610076-101610098 GGAGAACTGCTTGAACCTGGGGG - Intergenic
960481999 3:118202977-118202999 GGAGAATTGCTTGAACCTGGGGG + Intergenic
960610106 3:119548069-119548091 GGAGAACTGCTTGAACCTGGGGG - Intronic
961731637 3:128969479-128969501 GGAGAATTGCTTAAACCTGGGGG + Exonic
961849530 3:129801550-129801572 GGAGAATTGCTTTAACCTGGGGG - Intronic
963063649 3:141245138-141245160 GGAGAATTGCTTGAACCTGGGGG - Intronic
963930580 3:151000263-151000285 GGAGAATTGCTTGAACCTGGGGG + Intergenic
964035597 3:152192683-152192705 GGAGAATTGCTTGAACCTGGAGG + Intergenic
964316138 3:155446148-155446170 GGAGAATTGCTTGAACCTGGAGG - Intronic
964384959 3:156137634-156137656 GGAGTATTGCTTGAACCTGGTGG - Intronic
964865810 3:161259251-161259273 GGAGAATTGCTTGAACCTGGCGG + Intergenic
965582837 3:170287817-170287839 GGAGAATTGCTTGAACCTGGAGG + Intronic
965752658 3:171992379-171992401 GGAGGACTGCTTGAGCCTGGAGG - Intergenic
966165957 3:177016595-177016617 GGAGAATCGCTTGCACCTGGGGG - Intergenic
966797553 3:183730153-183730175 TGAGAACTGCTTGAACCTGGGGG - Intronic
966923031 3:184626856-184626878 GGAGAATTGCTTGAACCTGGAGG + Intronic
967022179 3:185532417-185532439 GGAGGACTGCTTGTGCCTGGGGG + Intronic
967064556 3:185903338-185903360 GGAGAACTGCTTGAACCTGGGGG - Intergenic
967108116 3:186270214-186270236 GGAGGATTGCTTGAACCTGGAGG - Intronic
967197306 3:187039583-187039605 GCAGCAGTGCAGACACCTGGAGG + Intronic
967208720 3:187147990-187148012 GGAGAATTGCTTAAACCTGGAGG - Intronic
968145490 3:196294823-196294845 GGAGAATTGCTTGAACCTGGTGG - Intronic
968147485 3:196311775-196311797 GGAGAATTGCTTGAACCTGGGGG - Intronic
968315795 3:197724005-197724027 GGAGAATTGCTTGAACCTGGGGG + Intronic
968321415 3:197772001-197772023 GGAGAATCGCTTAAACCTGGGGG + Intronic
1202745418 3_GL000221v1_random:97001-97023 GGAGAATTGCTTGAACCTGGGGG - Intergenic
968766523 4:2473717-2473739 AGAGAATTGCTTAAACCTGGAGG + Intronic
968795760 4:2703335-2703357 GGAGAATTGCTTCAACCTGGGGG - Intronic
969294486 4:6261802-6261824 TGAATACTGATTACACCTGGTGG - Intergenic
969610416 4:8224937-8224959 GGAGCACTGCTGACACCTGAGGG - Intronic
970320852 4:14873969-14873991 GGAGAATTGCTTAAACCTGGGGG + Intergenic
970535187 4:17023336-17023358 GGAGAATTGCTTGAACCTGGGGG - Intergenic
970599103 4:17626913-17626935 GGAGAACTGCTTAAACCTCTGGG - Exonic
971140326 4:23918310-23918332 GGAGAATTGCTTGAACCTGGGGG - Intergenic
971319644 4:25595089-25595111 GGAGAATTGCTTGAACCTGGAGG + Intergenic
971359650 4:25925325-25925347 GGAGAATTGCTTGAACCTGGGGG - Intronic
971371201 4:26020585-26020607 GGAGAATTGCTTGAACCTGGAGG - Intergenic
971373470 4:26037144-26037166 AGAGAATTGCTTAAACCTGGAGG - Intergenic
971472901 4:27046145-27046167 GGAGAATTGCTTAAACCTGGGGG + Intergenic
972233522 4:37102497-37102519 GGATAATTGCTTAAACCTGGGGG + Intergenic
972325478 4:38011260-38011282 GGAGAATTGCTTGAACCTGGGGG + Intronic
972530295 4:39955507-39955529 GGAGAACTGCTTGAACCCGGGGG + Intronic
972571151 4:40311567-40311589 GGAGAATTGCTTAAATCTGGAGG + Intergenic
973610480 4:52631913-52631935 TGAGAACTGCTTGAACCTGGGGG + Intronic
973861865 4:55073421-55073443 GGAGAATTGCTTGAACCTGGGGG + Intergenic
974060875 4:57033958-57033980 GGAGAATTGCTTGAACCTGGAGG + Intronic
974793677 4:66720985-66721007 GGATAACTGCTTGAACCTGGAGG + Intergenic
974833773 4:67221949-67221971 GGAGAATTGCTTGAACCTGGAGG - Intergenic
975207533 4:71662417-71662439 GGAGAATTGCTTGAACCTGGAGG - Intergenic
975559785 4:75698402-75698424 GCAGCCCTGCTGACACCTAGAGG + Intronic
975618272 4:76269524-76269546 GGAGAATTGCTTGAACCTGGAGG + Intronic
976077303 4:81314162-81314184 GGAGAATTGCTTGAACCTGGAGG + Intergenic
976586818 4:86807664-86807686 GGACCACTGCCTACAACTGTTGG + Exonic
976602602 4:86951710-86951732 GGAGAATTGCTTGAACCTGGAGG - Intronic
976711158 4:88072943-88072965 GGAGGATTGCTTGAACCTGGAGG + Intronic
976840644 4:89428732-89428754 GGAGGATTGCTTGAACCTGGGGG + Intergenic
977245750 4:94629256-94629278 GGAGGATTGCTTGAACCTGGGGG + Intronic
977373680 4:96172263-96172285 AGAGAATTGCTTAAACCTGGAGG - Intergenic
977692821 4:99934700-99934722 GGAGAATTGCTTGAACCTGGAGG + Intronic
978237328 4:106474775-106474797 GGAGAATTGCTTGAACCTGGAGG - Intergenic
978369652 4:108017643-108017665 GGAGAATTGCTTGAACCTGGGGG - Intronic
980365850 4:131803958-131803980 GGAGAATTGCTTGAACCTGGAGG - Intergenic
980916982 4:139042822-139042844 GGAGAATTGCTTGAACCTGGGGG + Intronic
981979183 4:150771091-150771113 GGAGAAATGCTTCCACCAGGAGG - Intronic
982104095 4:151996823-151996845 GGAGAATTGCTTGAACCTGGAGG + Intergenic
982373524 4:154660575-154660597 GGAGAACTGCTTGAAGCTGGTGG + Intronic
982546454 4:156738974-156738996 GGAGCACTGCTGACATTTAGTGG + Intergenic
982608739 4:157546825-157546847 GGAGAATTGCTTGAACCTGGAGG + Intergenic
982725389 4:158901222-158901244 AGAGAATTGCTTAAACCTGGAGG - Intronic
983007612 4:162503877-162503899 GGAGAATTGCTTAAACCTGGAGG + Intergenic
983509388 4:168590968-168590990 GGAGAATTGCTTGAACCTGGGGG - Intronic
984451320 4:179906779-179906801 GGAGAATTGCTTGAACCTGGGGG - Intergenic
984696703 4:182786465-182786487 GGAGAATTGCTTGAACCTGGAGG + Intronic
984731957 4:183076591-183076613 GGAGAATTGCTTGAACCTGGGGG - Intergenic
984914851 4:184713298-184713320 GGAGAATTGCTTGAACCTGGCGG + Intronic
985118098 4:186611912-186611934 GGAGAATTGCTTGAACCTGGGGG - Intronic
1202756363 4_GL000008v2_random:66230-66252 GGAGAATTGCTTGAACCTGGGGG + Intergenic
986123212 5:4861523-4861545 GGAGAATTGCTTGAACCTGGGGG + Intergenic
986265963 5:6190635-6190657 GGAGAATTGCTTGAACCTGGGGG + Intergenic
986442187 5:7792302-7792324 GGAGAATTGCTTGAACCTGGAGG + Intronic
986678442 5:10211165-10211187 GGAGAATTGCTTGAACCTGGGGG + Intergenic
986727603 5:10610951-10610973 GGAGAATTGCTTGAACCTGGGGG + Intronic
986939638 5:12935437-12935459 GGAGCACAGCTTGCACCTGGAGG - Intergenic
987035336 5:14013442-14013464 GGAGAATTGCTTGAACCTGGAGG - Intergenic
987112020 5:14697265-14697287 GGAGAACTGCTTGAACCAGGAGG - Exonic
987311450 5:16684954-16684976 GGAGAATTGCTTGAACCTGGAGG + Intronic
987404740 5:17513025-17513047 GGAGAATTGCTTGAACCTGGGGG + Intergenic
987412349 5:17626750-17626772 GGAGAATTGCTTGGACCTGGGGG + Intergenic
987587392 5:19873736-19873758 GGAGAATTGCTTGAACCTGGGGG - Intronic
988275327 5:29074474-29074496 GGAGAATTGCTTAAACCCGGGGG + Intergenic
988693187 5:33593184-33593206 GGAGAATTGCTTGGACCTGGAGG + Intronic
988995831 5:36714297-36714319 GGAGAACTGCTTAAACCTCAGGG - Intergenic
989037738 5:37193073-37193095 GGAGAATTGCTTGAACCTGGAGG + Intronic
989054173 5:37350710-37350732 GGAGAACTGCTTAAACCCAGGGG + Intronic
989451632 5:41593434-41593456 GGAGAACTGCTTGAACCTGGAGG - Intergenic
989549238 5:42714002-42714024 GGAGAATTGCTTGAACCTGGGGG - Intronic
990274411 5:54179925-54179947 GGAGAATCGCTTAAACCTGGGGG + Intronic
990433183 5:55757952-55757974 GGAGAATTGCTTGAACCTGGGGG + Intronic
990454613 5:55972912-55972934 GGAGAATTGCTTGAACCTGGGGG + Intronic
990584510 5:57197446-57197468 GGAGAACTGCTTGAACCAGGAGG - Intronic
991021018 5:61980276-61980298 GGAGAATTGCTTGAACCTGGTGG + Intergenic
991086692 5:62654244-62654266 GGAGAATTGCTTGAACCTGGAGG - Intergenic
991390791 5:66141555-66141577 GGAGGACTGCTTGAGCCTGGGGG - Intronic
991713435 5:69430275-69430297 GGAGAATTGCTTAAACCTGGAGG + Intronic
991773756 5:70063904-70063926 GGAGAATTGCTTGAACCTGGGGG + Intronic
991853050 5:70939328-70939350 GGAGAATTGCTTGAACCTGGGGG + Intronic
991923887 5:71684454-71684476 CTAGCCCTGCCTACACCTGGTGG + Intergenic
992304538 5:75422524-75422546 GGAGGACTGCTTGGGCCTGGGGG + Intronic
992423053 5:76626361-76626383 GGAGGATTGCTTGAACCTGGTGG - Intronic
992699977 5:79332166-79332188 GGAGAACTGCTTGAACCTGGGGG - Intergenic
992819577 5:80482953-80482975 GGAGAACTGCTTGAACCGGGAGG - Intergenic
992838209 5:80660887-80660909 GGAGAATTGCTTAAACTTGGCGG - Intronic
993728000 5:91390276-91390298 GGAGAACTGCTTGAACCTGGTGG + Intergenic
993764956 5:91844790-91844812 GGAGAATTGCTTGAACCTGGAGG - Intergenic
993765064 5:91845460-91845482 GGAGAATTGCTTGAACCTGGAGG + Intergenic
994074713 5:95637463-95637485 GGAGAATTGCTTGAACCTGGAGG + Intergenic
994922351 5:106063852-106063874 GGAGAATTGCTTGAACCTGGAGG + Intergenic
995510261 5:112901870-112901892 GGAGAATTGCTTGAACCTGGGGG + Intronic
995723120 5:115157471-115157493 GGAGAATTGCTTGAACCTGGTGG + Intronic
995884075 5:116873780-116873802 AGAGAATTGCTTAAACCTGGAGG - Intergenic
996279023 5:121704947-121704969 GGAGAATTGCTTGAACCTGGGGG + Intergenic
996576839 5:124984898-124984920 GGTGCCCTCCTTATACCTGGAGG + Intergenic
996739278 5:126784445-126784467 AGAGAATTGCTTAAACCTGGAGG - Intronic
996820878 5:127626204-127626226 TGAGCACTGCTCAACCCTGGGGG - Intergenic
997497246 5:134339062-134339084 GGAGAACTGCTTGAACCCGGAGG + Intronic
998116378 5:139540901-139540923 GGAGAATTGCTTGAACCTGGAGG + Intronic
998410798 5:141909872-141909894 GGAGAATCGCTTAAACCTGGAGG - Intergenic
998464017 5:142328649-142328671 GGAGAATTGCTTAAACCTGGAGG + Intergenic
998967435 5:147555690-147555712 GGAGAACTGCTTGAACCGGGAGG + Intergenic
999447069 5:151648687-151648709 GGAGAATTGCTTGAACCTGGGGG - Intergenic
999454927 5:151707368-151707390 GGAGAATTGCTTGAACCTGGGGG - Intergenic
999589095 5:153124234-153124256 GGAGGATTGCTTCAACCTGGAGG + Intergenic
1000048210 5:157539060-157539082 GGAGAACTGCTTGAACCTGGGGG + Intronic
1000071168 5:157742475-157742497 AGAGAATTGCTTAAACCTGGAGG - Intergenic
1000304729 5:159984816-159984838 GGAGAATTGCTTGAACCTGGGGG + Intergenic
1000329400 5:160195192-160195214 GGAGAATTGCTTGAACCTGGAGG + Intronic
1000389345 5:160707039-160707061 GGAGAATTGCTTGAACCTGGGGG - Intronic
1000559802 5:162771529-162771551 GGAGAATTGCTTGAACCTGGAGG + Intergenic
1000608879 5:163354146-163354168 AGAGAATTGCTTAAACCTGGAGG - Intergenic
1001625959 5:173132688-173132710 GGAGAACTGCTTGAACCCGGGGG - Intronic
1001689471 5:173622202-173622224 AGAGAATTGCTTAAACCTGGAGG - Intergenic
1002126291 5:177047427-177047449 GGAGAATTGCTTGAACCTGGTGG - Intronic
1002258423 5:177977301-177977323 GGAGAACTGCTTGAACCGGGAGG + Intergenic
1002308703 5:178300155-178300177 AGAGAATTGCTTAAACCTGGAGG - Intronic
1002514112 5:179744274-179744296 GGAGAACTGCTTAAACCCGGGGG - Intronic
1002902121 6:1418045-1418067 GGAGAATTGCTTGAACCTGGAGG - Intergenic
1002942946 6:1733759-1733781 GGAGGATTGCTTGAACCTGGGGG + Intronic
1003341110 6:5221600-5221622 GGAGAACTGCTTGAACCCGGAGG + Intronic
1004149892 6:13106566-13106588 GGAGGATTGCTTGAACCTGGAGG - Intronic
1004274149 6:14221043-14221065 GGAGCCCTCCTTACACTTAGAGG - Intergenic
1004350157 6:14883780-14883802 GGAGAACTGCTTGAACCCGGGGG + Intergenic
1004376190 6:15092712-15092734 GGTGCTCTCCCTACACCTGGAGG + Intergenic
1004556537 6:16703926-16703948 GGAGAATTGCTTGAACCTGGGGG + Intronic
1004731955 6:18367157-18367179 GGAGAATTGCTTGAACCTGGGGG - Intergenic
1004741829 6:18469282-18469304 GGAGAATTGCTTGAACCTGGAGG + Intergenic
1005111111 6:22283242-22283264 GGAGAATTGCTTCAACCTGGGGG - Intergenic
1005325493 6:24695965-24695987 GGAGGATTGCTTGAACCTGGAGG + Intronic
1005579070 6:27216673-27216695 CGAGAATGGCTTACACCTGGAGG - Intergenic
1005586320 6:27279812-27279834 GGAGCCCAGCCTGCACCTGGAGG + Intergenic
1005751552 6:28887311-28887333 GGAGAATTGCTTAAACCTGGAGG + Intergenic
1005840071 6:29738564-29738586 GCAGCTGTGCTCACACCTGGAGG - Intergenic
1006323368 6:33334310-33334332 GGAGAATTGCTTGAACCTGGAGG + Intergenic
1006427479 6:33975466-33975488 GGAGAATTGCTTGAACCTGGAGG + Intergenic
1006759954 6:36451576-36451598 GGAGGACTGCTTAAGCCCGGAGG - Intronic
1006760276 6:36454726-36454748 GGAGAACTGCTTGAACCCGGCGG - Intronic
1006777319 6:36605397-36605419 GGAGAAGTGCTTAAACCTGGTGG + Exonic
1007599659 6:43073959-43073981 CAAGCACTGCTCTCACCTGGAGG - Exonic
1007770062 6:44184957-44184979 GGAGAACTGCTTGAACCTGGGGG + Intergenic
1007795120 6:44340991-44341013 GGAGAACTGCTTGAACCCGGGGG - Intronic
1007957905 6:45933890-45933912 GGAGCACAGCTCACAGGTGGGGG + Intronic
1008111728 6:47502365-47502387 GGAGCACTGCTTGACCCAGGAGG - Intronic
1008902210 6:56633589-56633611 GGAGAATTGCTTGGACCTGGGGG - Intronic
1009195193 6:60676610-60676632 GGAGAATTGCTTGAACCTGGGGG - Intergenic
1009666736 6:66690963-66690985 GGAGAATTGCTTGAACCTGGAGG + Intergenic
1009967086 6:70589254-70589276 GGAGAATTGCTTGAACCTGGCGG - Exonic
1010089725 6:71966610-71966632 GGAGAACTGCTTAAACTGGGAGG - Intronic
1010165809 6:72914002-72914024 GGTGCCCTCCCTACACCTGGAGG - Intronic
1010433094 6:75800809-75800831 CGAGAACTGCTTGAACCTGGGGG - Intronic
1010726188 6:79336591-79336613 GGAGAATTGCTTGAACCTGGGGG - Intergenic
1010881894 6:81186585-81186607 TGAGAACTGTTTCCACCTGGGGG - Intergenic
1011420395 6:87165846-87165868 GGAGAATCGCTTAAACCTGGAGG - Intronic
1011666737 6:89641813-89641835 GGAGAACTGCTTGAACCAGGAGG - Intergenic
1011718176 6:90128488-90128510 GGAGAATTGCTTGAACCTGGGGG + Intronic
1011845364 6:91556700-91556722 GGAGGACTGCTTGAGCCTGGTGG + Intergenic
1012402884 6:98858945-98858967 GGAGGACAGCTTCCACCAGGAGG - Intergenic
1013274844 6:108574059-108574081 AGAGAACTGCTTAAACCTGGAGG + Intronic
1013510305 6:110838766-110838788 GGAGAATCGCTTAAACCTGGAGG + Intronic
1013671826 6:112411941-112411963 GGAGAATTGCTTCAACCTGGAGG + Intergenic
1014101322 6:117515108-117515130 GGAGAATTGCTTGAACCTGGGGG - Intronic
1015101626 6:129488217-129488239 GGAGAAATGCTTAAACCAGGGGG + Intronic
1015758626 6:136633306-136633328 GGAGCACTGCTTGAACCCGGGGG + Intronic
1016259621 6:142151941-142151963 GGAGAATTGCTTGAACCTGGAGG + Intronic
1016689812 6:146924165-146924187 GGAGAATTGCTTGAACCTGGGGG + Intergenic
1016971612 6:149769402-149769424 GGAGAACTGCTTGAACCCGGAGG - Intronic
1017330916 6:153197647-153197669 GGAGAATTGCTTGAACCTGGGGG - Intergenic
1017540114 6:155392761-155392783 GGAGAATTGCTTGCACCTGGAGG + Intergenic
1017841834 6:158228621-158228643 GGAGAATTGCTTGAACCTGGGGG - Intergenic
1018205272 6:161431046-161431068 GGAGAATTGCTTGAACCTGGGGG + Intronic
1018208173 6:161455127-161455149 GGAGCATTGCTTGAACCCGGGGG - Intronic
1018387673 6:163319385-163319407 AGAGAATTGCTTAAACCTGGAGG + Intergenic
1018622173 6:165740419-165740441 GGAGAATTGCTTGAACCTGGGGG - Intronic
1019303650 7:322272-322294 GGCGCTCTGCTGCCACCTGGTGG - Intergenic
1019411573 7:909002-909024 GGAGCACTGCTGTCACCTGCTGG - Intronic
1019517236 7:1445413-1445435 GGAGCACTGCTTACACCTGGGGG + Exonic
1019730846 7:2628690-2628712 GGAGAACAGCTTAAACCCGGGGG - Intergenic
1019960751 7:4457416-4457438 GGAGAATTGCTTGAACCTGGCGG + Intergenic
1020147466 7:5655513-5655535 GGAGAATTGCTTGAACCTGGGGG + Intronic
1020197923 7:6056500-6056522 AGAGAACTGCTTAAACCTGGAGG + Intronic
1020250980 7:6468417-6468439 GGAGAACCACTTAAACCTGGAGG - Intronic
1020338311 7:7082073-7082095 GGAGAATTGCTTGAACCTGGAGG + Intergenic
1020892758 7:13900036-13900058 GGAGAACTGCTTGAACCTGGGGG + Intronic
1021064311 7:16154896-16154918 GGAGAATTGCTTGAACCTGGGGG - Intronic
1021531517 7:21651452-21651474 AGAGAATTGCTTAAACCTGGAGG - Intronic
1022074467 7:26953860-26953882 GGAGAATTGCTTGAACCTGGGGG - Intronic
1022261166 7:28706263-28706285 GGAGAATTGCTTGAACCTGGGGG + Intronic
1022426808 7:30276910-30276932 GGAGAATTGCTTAAACCCGGGGG + Intergenic
1022742261 7:33134138-33134160 GGAGAATTGCTTGAACCTGGAGG - Intronic
1023325766 7:39054010-39054032 GGAGAATTGCTTGAACCTGGAGG + Intronic
1023443597 7:40209405-40209427 GGAGAACTGCTTGAACCGGGAGG + Intronic
1023541516 7:41271554-41271576 GGAGAATTGCTTGAACCTGGGGG - Intergenic
1023808435 7:43891870-43891892 GGAGAATTGCTTGAACCTGGGGG - Intronic
1024615988 7:51112434-51112456 GAAGCACTGCTTGCTTCTGGAGG - Intronic
1025191790 7:56901305-56901327 GGAGGACTGCTTGAGCCTGGGGG - Intergenic
1025221179 7:57109716-57109738 GGAGAATTGCTTGAACCTGGAGG - Intergenic
1025650591 7:63464855-63464877 GGAGAATTGCTTGAACCTGGAGG + Intergenic
1025680160 7:63675629-63675651 GGAGGACTGCTTGAGCCTGGGGG + Intergenic
1025988939 7:66480103-66480125 GGAGAATTGCTTAAGCCTGGTGG + Intergenic
1026031988 7:66802223-66802245 GGAGTACTACTAACACCTAGTGG + Intronic
1026041681 7:66873395-66873417 GGAGAATTGCTTGAACCTGGAGG + Intergenic
1026474587 7:70723980-70724002 GGAGAACTGCTTGAACCGGGAGG - Intronic
1026561754 7:71456153-71456175 GGAGAATTGCTTGAACCTGGGGG + Intronic
1026592545 7:71709687-71709709 GGAGAATTGCTTGAACCTGGGGG - Intronic
1026725669 7:72868312-72868334 GGAGAATTGCTTAAACCCGGGGG - Intergenic
1026872587 7:73862195-73862217 GGAGAATTGCTTGAACCTGGAGG - Intronic
1026953481 7:74362623-74362645 GGAGAATTGCTTGAACCTGGAGG - Intronic
1027163342 7:75817919-75817941 GGAGAATTGCTTGAACCTGGGGG - Intronic
1027211900 7:76156110-76156132 GGAGAATTGCTTAAGCCTGGTGG + Intergenic
1027282089 7:76616191-76616213 GGAGAATTGCTTGCACCCGGAGG + Intronic
1027670324 7:81088530-81088552 AGAGAATTGCTTAAACCTGGGGG - Intergenic
1028438207 7:90829621-90829643 GGAGAACTGCTTGAACCTGGGGG - Intronic
1028663670 7:93314972-93314994 GGGGCTCTGCTTATACCTTGGGG - Intronic
1028755382 7:94427657-94427679 CCACCACCGCTTACACCTGGAGG - Exonic
1028896771 7:96049940-96049962 GGAGAATTGCTTGAACCTGGAGG + Intronic
1029056166 7:97745046-97745068 GGAGAATTGCTTGAACCTGGCGG + Intergenic
1029139921 7:98402003-98402025 GGAGAATTGCTTAAACCTGGGGG - Intergenic
1029206500 7:98872090-98872112 GGAGAATTGCTTGAACCTGGAGG + Intergenic
1029563216 7:101317859-101317881 GGAGAACTGCTTGAACCTGGAGG - Intronic
1029579875 7:101429012-101429034 GTAGAACTGCTTGAACCTGGAGG - Intronic
1029661363 7:101964260-101964282 GGAGAATTGCTTGAACCTGGGGG + Intronic
1030037281 7:105418623-105418645 GGAGAATTGCTTGAACCTGGGGG - Intergenic
1030205477 7:106948623-106948645 GGGTCACTTCTTCCACCTGGAGG + Intergenic
1030221320 7:107102113-107102135 AGAGAATTGCTTAAACCTGGAGG + Intronic
1030376523 7:108758636-108758658 GGAGAATTGCTTGAACCTGGGGG + Intergenic
1030498472 7:110329508-110329530 GGAGAATTGCTTGAACCTGGGGG - Intergenic
1031120924 7:117720601-117720623 GGAGAATTGCTTGAACCTGGAGG + Intronic
1031754909 7:125626536-125626558 GGAGAATTGCTTGAACCTGGGGG + Intergenic
1032006363 7:128305066-128305088 GAAGAACTGCTTGAACCTGGGGG + Exonic
1032396059 7:131590937-131590959 GGAGAATTGCTTAAACCCGGAGG - Intergenic
1032514478 7:132496490-132496512 GGAGAATTGCTTGAACCTGGCGG - Intronic
1032667508 7:134051578-134051600 AGAGAATTGCTTAAACCTGGAGG + Intronic
1033439811 7:141368226-141368248 GGAGAATTGCTTGAACCTGGGGG + Intronic
1034573449 7:151976756-151976778 GGAGAATTGCTTGAACCTGGAGG - Intronic
1034866065 7:154643557-154643579 GGAGAATTGCTTGAACCTGGGGG - Intronic
1036460804 8:8950749-8950771 GGAGAATTGCTTGAACCTGGGGG + Intergenic
1036814676 8:11892792-11892814 GGAGAATTGCTTGAACCTGGGGG - Intergenic
1037105004 8:15096165-15096187 GGAGAATTGCTTGAACCTGGAGG - Intronic
1037598482 8:20373941-20373963 GGAGCCTTCCTAACACCTGGAGG + Intergenic
1037694982 8:21215706-21215728 AGAGCACTGCTAAGCCCTGGAGG + Intergenic
1037966932 8:23142177-23142199 AGAGAACTGCTTAAACCTGGAGG + Intronic
1038014349 8:23500950-23500972 AGAGGATTGCTTGCACCTGGAGG + Intergenic
1038628854 8:29221191-29221213 GGAGAATTGCTTGAACCTGGGGG - Intronic
1038795659 8:30707042-30707064 GGAGAATTGCTTGAACCTGGCGG + Intronic
1039528503 8:38237283-38237305 AGAGAACTGCTTGAACCTGGGGG + Intronic
1039544444 8:38398808-38398830 GGAGAATTGCTTGAACCTGGGGG - Intronic
1039675973 8:39667309-39667331 GGAGAATTGCTTGAACCTGGGGG + Intronic
1039820936 8:41134800-41134822 GGAGAATTGCTTGAACCTGGGGG - Intergenic
1039852379 8:41380440-41380462 GGAGAATTGCTTGAACCTGGGGG - Intergenic
1039956388 8:42210261-42210283 GGAGAATTGCTTGAACCTGGTGG - Intergenic
1042266477 8:66913871-66913893 GGAGAATTGCTTGAACCTGGTGG + Intronic
1042280270 8:67048622-67048644 AGATAACTGCTTAAACCTGGAGG + Intronic
1042288400 8:67140172-67140194 GGAGAATTGCTTGAACCTGGAGG - Intronic
1042604096 8:70528702-70528724 GGAGAATTGCTTGAACCTGGAGG + Intergenic
1042857602 8:73283950-73283972 GGAGAACTGCTTGAACCTGGAGG + Intergenic
1043445545 8:80316137-80316159 GGAGAATTGCTTGAACCTGGGGG - Intergenic
1044382213 8:91547595-91547617 GGAGGATTGCTTGAACCTGGCGG + Intergenic
1045513246 8:102831863-102831885 GGAGGACTGCTTAAGCCGGGAGG + Intronic
1045530339 8:102979104-102979126 GGAGAATTGCTTGAACCTGGAGG - Intergenic
1046402538 8:113723405-113723427 GAAGAACTGCTTGAACCTGGAGG - Intergenic
1046567769 8:115922463-115922485 GGAGAATTGCTTGAACCTGGGGG + Intergenic
1046893485 8:119448628-119448650 GGAGAATTGCTTGCACCTGGAGG + Intergenic
1047417192 8:124674434-124674456 GGAGAATTGCTTGCACCAGGAGG - Intronic
1047462397 8:125079279-125079301 GGAGAATTGCTTGAACCTGGAGG - Intronic
1047853234 8:128881520-128881542 GGAGAATTGCTTGAACCTGGGGG + Intergenic
1047903952 8:129453209-129453231 AGAGAATTGCTTAAACCTGGAGG - Intergenic
1047937359 8:129796113-129796135 GGAGAATTGCTTGTACCTGGGGG - Intergenic
1047940591 8:129824533-129824555 GGAGAATTGCTTGAACCTGGAGG + Intergenic
1047987619 8:130251325-130251347 GGAGAAGTGCTTGAACCTGGGGG + Intronic
1048259098 8:132930589-132930611 GGAGAATTGCTTGAACCTGGTGG + Intronic
1048819260 8:138364935-138364957 GGAGAACTGCTTGAACCAGGAGG - Intronic
1049114812 8:140676846-140676868 GGAGAATTGCTTGAACCTGGTGG + Intronic
1049139711 8:140941978-140942000 GGAGAATTGCTTGAACCTGGGGG - Intronic
1049412646 8:142480159-142480181 GGAGCCCTGCTTTCTCCTTGAGG - Intronic
1049638644 8:143704007-143704029 GGAGAACTGCTTGAAGCTGGAGG - Intronic
1049691647 8:143963731-143963753 GGAGGATTGCTTAACCCTGGAGG - Intronic
1049715907 8:144091753-144091775 GGAGAATTGCTTGAACCTGGAGG - Intergenic
1050466891 9:5936263-5936285 GGAGGACTGCTTGAGCCTGGAGG + Intronic
1050559652 9:6821723-6821745 GGAGAACTGCTTGAACCCGGGGG - Intronic
1050742569 9:8839413-8839435 GGAGAATTGCTTGAACCTGGAGG - Intronic
1051262850 9:15281764-15281786 GGAGAATTGCTTGAACCTGGGGG - Intronic
1051662520 9:19439428-19439450 GGAGAATTGCTTGAACCTGGAGG - Intronic
1051938481 9:22473511-22473533 GGAGAATTGCTTGAACCTGGAGG + Intergenic
1052297026 9:26908255-26908277 GGAGAATTGCTTGAACCTGGGGG - Intronic
1052769202 9:32671939-32671961 GGAGAACTGCTTTCGCCTGATGG + Intergenic
1052962549 9:34312786-34312808 GGAGAATTGCTTGAACCTGGAGG - Intronic
1053028806 9:34756993-34757015 GGAGAATTGCTTGAACCTGGGGG - Intergenic
1053134804 9:35643893-35643915 GGAGAATTGCTTAAATCTGGAGG + Intronic
1054782952 9:69182877-69182899 GGAGAATTGCTTGAACCTGGAGG - Intronic
1055431813 9:76251470-76251492 GGAGAATTGCTTAAACCTGGAGG + Intronic
1056903044 9:90619046-90619068 GGAGAATTGCTTGAACCTGGGGG + Intronic
1057066248 9:92054820-92054842 GGAGAACTGCTTGAACCTCGGGG + Intronic
1057093030 9:92277332-92277354 GGAGAATTGCTTGAACCTGGGGG + Intronic
1057210459 9:93198439-93198461 GGAGCCCTGCTTACCCCGGTAGG + Intronic
1057365569 9:94417534-94417556 GGAGAATTGCTTGAACCTGGGGG + Intronic
1057505966 9:95633789-95633811 GGAGAACCGCTTGAACCTGGAGG + Intergenic
1057636239 9:96770509-96770531 GGAGAACTGCTTGAACCTGAGGG + Intronic
1057657751 9:96970539-96970561 GGAGAATTGCTTGAACCTGGGGG - Intronic
1058617385 9:106845909-106845931 AGAGAATTGCTTAAACCTGGAGG - Intergenic
1059145370 9:111895457-111895479 AGAGAATTGCTTAAACCTGGAGG - Intergenic
1059197319 9:112382168-112382190 GGAGAACCGCTTGAACCTGGAGG + Intronic
1059464525 9:114459371-114459393 GGAGAATTGCTTGAACCTGGGGG + Intronic
1059616271 9:115954877-115954899 GGAGAATTGCTTGAACCTGGGGG - Intergenic
1059643229 9:116237808-116237830 GGAGAATTGCTTATACCTGGGGG - Intronic
1060256350 9:122034566-122034588 GGAGCACAGCTTAGATATGGAGG - Intronic
1060369334 9:123055280-123055302 GGAGGACTGCTTGAGCCTGGGGG - Intronic
1060677299 9:125527156-125527178 AGAGAATTGCTTAAACCTGGGGG - Intronic
1060741342 9:126099554-126099576 GGAGCAGTGCTTCATCCTGGAGG + Intergenic
1061047523 9:128174747-128174769 GGAGAATTGCTTGAACCTGGGGG - Intronic
1061309830 9:129754962-129754984 GGAGAATTGCTTGAACCTGGAGG - Intergenic
1061339823 9:129970974-129970996 GGAGAATTGCTTGAACCTGGAGG - Intronic
1061679110 9:132234117-132234139 GGAGAATTGCTTGAACCTGGGGG - Intronic
1061912001 9:133729888-133729910 TCAGCTCTGCTGACACCTGGTGG + Intronic
1061948660 9:133923216-133923238 GGAGCCCCGCTCACAGCTGGTGG + Intronic
1061966668 9:134018357-134018379 GGGGAACTGCTTGAACCTGGTGG + Intergenic
1062310913 9:135936584-135936606 AGAGAATTGCTTAAACCTGGGGG - Intronic
1062559106 9:137131443-137131465 GGAGAATTGCTTGAACCTGGAGG + Intergenic
1203714039 Un_KI270742v1:126951-126973 GGAGAATTGCTTGAACCTGGGGG - Intergenic
1203537162 Un_KI270743v1:51087-51109 GGAGAATTGCTTGAACCTGGGGG + Intergenic
1185640257 X:1586609-1586631 AGAGAATTGCTTAAACCTGGAGG - Intergenic
1185697436 X:2205869-2205891 GGAGAATTGCTTTAACCTGGGGG - Intergenic
1185881459 X:3744931-3744953 GGAGGATTGCTTGAACCTGGGGG + Intergenic
1186764376 X:12755861-12755883 GGAGAATTGCTTGAACCTGGGGG - Intergenic
1187396265 X:18922153-18922175 GGAGAATTGCTTGAACCTGGGGG + Intronic
1187635870 X:21227541-21227563 GGAGAACTGCTTGAACCCGGGGG + Intergenic
1188322822 X:28760993-28761015 GGAGAATTGCTTGAACCTGGGGG + Intronic
1188349686 X:29112888-29112910 AGAGAACTGCTTGAACCTGGGGG - Intronic
1189019313 X:37318181-37318203 GGAGAATTGCTTGAACCTGGGGG - Intergenic
1189794990 X:44636913-44636935 GGAGAATTGCTTGAACCTGGGGG + Intergenic
1189811628 X:44786105-44786127 GGAGAAGTGCTTTAACCTGGGGG - Intergenic
1189975631 X:46459221-46459243 GGAGAATTGCTTGAACCTGGGGG + Intronic
1190312673 X:49128192-49128214 GGAGAATTGCTTGAACCTGGGGG - Intergenic
1190569091 X:51763758-51763780 GGAGAATTGCTTAAACCTGGGGG - Intergenic
1190747487 X:53333235-53333257 GGAGAATTGCTTGAACCTGGAGG - Intergenic
1192350466 X:70351846-70351868 GGAGAATTGCTTAAACCTGGGGG - Intronic
1192483494 X:71505038-71505060 GGAGGACTGCTTGATCCTGGGGG + Intronic
1193117920 X:77793529-77793551 GGAGAATTGCTTGAACCTGGGGG - Intergenic
1193248113 X:79254612-79254634 GGAGAATTGCTTGAACCTGGGGG - Intergenic
1193508735 X:82373268-82373290 GGCACTCTGCTTTCACCTGGAGG + Intergenic
1194918573 X:99734809-99734831 GGAGAACTGCTTGAACCTTGGGG + Intergenic
1195753034 X:108176232-108176254 GGAGAATTGCTTGAACCTGGGGG + Intronic
1196842953 X:119875413-119875435 GGAGAATTGCTTGAACCTGGTGG - Intronic
1197144229 X:123153856-123153878 GGAGAATTGCTTAAATCTGGGGG - Intergenic
1197797945 X:130318073-130318095 GGAGAATTGCTTGAACCTGGCGG + Intergenic
1198213133 X:134533488-134533510 GGAGAACTGCTTGAACCGGGAGG + Intergenic
1198387454 X:136143372-136143394 GGAGAATCGCTTAAACCTGGTGG + Intergenic
1198467763 X:136918793-136918815 GGAGAATTGCTTGAACCTGGGGG - Intergenic
1199227614 X:145395772-145395794 GGAGAATTGCTTGAACCTGGGGG - Intergenic
1199264713 X:145817550-145817572 GGAGCACTGCTCACGCCTCTCGG - Intergenic
1199591850 X:149475201-149475223 GGAGAATTGCTTGAACCTGGGGG - Intergenic
1199733588 X:150662412-150662434 GGAGAATTGCTTGAACCTGGGGG - Intronic
1200112834 X:153751194-153751216 GGAGAATTGCTTGAACCTGGGGG - Intergenic
1200168454 X:154053695-154053717 GGAGGATTGCTTGAACCTGGAGG - Intronic
1200182519 X:154159390-154159412 GGAGTACAGTCTACACCTGGAGG + Intergenic
1200188173 X:154196504-154196526 GGAGTACAGTCTACACCTGGAGG + Intergenic
1200193823 X:154233644-154233666 GGAGTACAGTCTACACCTGGAGG + Intergenic
1200199578 X:154271448-154271470 GGAGTACAGTCTACACCTGGAGG + Exonic
1200295947 X:154920541-154920563 GGAGGACTGCTTGAGCCTGGGGG - Intronic
1200319644 X:155173954-155173976 AGAGAATTGCTTAAACCTGGAGG - Intergenic