ID: 1019517935

View in Genome Browser
Species Human (GRCh38)
Location 7:1447855-1447877
Sequence CTTGGTGCCCGGGGGGGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 161}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019517923_1019517935 -4 Left 1019517923 7:1447836-1447858 CCCAGTGCCCAGCACAGGCCTTG 0: 1
1: 1
2: 43
3: 221
4: 1001
Right 1019517935 7:1447855-1447877 CTTGGTGCCCGGGGGGGACCTGG 0: 1
1: 0
2: 0
3: 17
4: 161
1019517919_1019517935 8 Left 1019517919 7:1447824-1447846 CCCTCCAGAGGTCCCAGTGCCCA 0: 1
1: 0
2: 3
3: 35
4: 374
Right 1019517935 7:1447855-1447877 CTTGGTGCCCGGGGGGGACCTGG 0: 1
1: 0
2: 0
3: 17
4: 161
1019517920_1019517935 7 Left 1019517920 7:1447825-1447847 CCTCCAGAGGTCCCAGTGCCCAG 0: 1
1: 0
2: 7
3: 31
4: 335
Right 1019517935 7:1447855-1447877 CTTGGTGCCCGGGGGGGACCTGG 0: 1
1: 0
2: 0
3: 17
4: 161
1019517921_1019517935 4 Left 1019517921 7:1447828-1447850 CCAGAGGTCCCAGTGCCCAGCAC 0: 1
1: 0
2: 3
3: 45
4: 397
Right 1019517935 7:1447855-1447877 CTTGGTGCCCGGGGGGGACCTGG 0: 1
1: 0
2: 0
3: 17
4: 161
1019517924_1019517935 -5 Left 1019517924 7:1447837-1447859 CCAGTGCCCAGCACAGGCCTTGG 0: 1
1: 6
2: 25
3: 216
4: 993
Right 1019517935 7:1447855-1447877 CTTGGTGCCCGGGGGGGACCTGG 0: 1
1: 0
2: 0
3: 17
4: 161
1019517917_1019517935 30 Left 1019517917 7:1447802-1447824 CCTGGCTCTGAAAGGGTCTAGTC 0: 1
1: 0
2: 1
3: 5
4: 86
Right 1019517935 7:1447855-1447877 CTTGGTGCCCGGGGGGGACCTGG 0: 1
1: 0
2: 0
3: 17
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019517935 Original CRISPR CTTGGTGCCCGGGGGGGACC TGG Intronic
900151429 1:1180834-1180856 CAAGGTGCCGGGGGGGGTCCAGG + Exonic
900633289 1:3649912-3649934 CCTGGTGAGCGGCGGGGACCTGG - Exonic
903236374 1:21953123-21953145 CCTGGTGGCAGGCGGGGACCAGG - Intergenic
904211058 1:28887239-28887261 CTCGGTCCCCGGGAGGGACGGGG + Intronic
904455934 1:30648043-30648065 CTTGGTGCCCTGTGGGTACTTGG - Intergenic
905014966 1:34771605-34771627 CTTGGGGCCCCAGGGGTACCTGG - Intronic
905653158 1:39669681-39669703 CTTGGTGCCTGGGGAGGAAATGG + Intronic
906727541 1:48054951-48054973 ATGGGTGCCCGTGGGGGAACTGG + Intergenic
915344690 1:155191709-155191731 GGTGGAGCCCGGGGCGGACCTGG + Intronic
916108641 1:161447903-161447925 CCAGGTGCCCGGCGGGGACACGG + Intergenic
916110229 1:161455284-161455306 CCAGGTGCCCGGCGGGGACACGG + Intergenic
916111814 1:161462694-161462716 CCAGGTGCCCGGCGGGGACACGG + Intergenic
916113401 1:161470075-161470097 CCAGGTGCCCGGCGGGGACACGG + Intergenic
918383753 1:183984519-183984541 CTTGGTGGCTGGCGGGTACCAGG - Intronic
919757983 1:201077830-201077852 CGTGGTGCCTGCCGGGGACCCGG + Intronic
919825149 1:201498340-201498362 CTTGGTGCCGGGGGTTGCCCAGG + Intronic
920044283 1:203123536-203123558 CTTGGTACCCAGGAGGGTCCTGG - Intronic
1064380681 10:14838750-14838772 CAGGGTGCCCGGGGGGGTCCCGG + Intronic
1064380697 10:14838787-14838809 CTGGGTGTCCCGGGGGGTCCCGG + Intronic
1065208785 10:23382392-23382414 CCTGGGGCCCAGGGGGGAGCGGG + Intergenic
1065660212 10:27998666-27998688 CTTGGTCCCCGGGAGGGAAAGGG + Intronic
1071132663 10:82413297-82413319 CTTGGAGCTCTGGGGTGACCAGG + Intronic
1076599218 10:131646199-131646221 GTTGGTGCCTGGTGAGGACCAGG - Intergenic
1077136432 11:1001713-1001735 CTTGGTGGCAGGAAGGGACCAGG + Intronic
1077331215 11:1984559-1984581 CCTGGGGCCCGAGGGGGGCCTGG - Intergenic
1083327517 11:61880312-61880334 CCTGGGGCCCTGGGAGGACCAGG - Intronic
1083581272 11:63827021-63827043 CTTGGTGCCCTGGGGGTGCCTGG - Exonic
1083714122 11:64565907-64565929 CTTGGGTCCCGGGGAGGGCCAGG - Intronic
1202814196 11_KI270721v1_random:39735-39757 CCTGGGGCCCGAGGGGGGCCTGG - Intergenic
1091688376 12:2579497-2579519 CATGGTGCAAGGGAGGGACCTGG + Intronic
1095219793 12:39596796-39596818 GTTGGTGCCCAGGGTGGAACTGG + Intronic
1101949380 12:109162673-109162695 CCTGGAGCCCCGGGGGGAACGGG - Intronic
1104715399 12:131012888-131012910 CTGGGTGACCGCGGGGGGCCCGG + Intronic
1104997058 12:132664651-132664673 CTTGGTGCCCAGGAAGGATCTGG + Intronic
1106422576 13:29595766-29595788 ATTGGTGCCCGGCGGTGACGCGG - Intergenic
1114224127 14:20723249-20723271 CTCGGGGCCCGGGGGGGAAGGGG - Intergenic
1120881051 14:89416101-89416123 CTGGGTGGGCGGGGGTGACCCGG - Intronic
1121113495 14:91328377-91328399 CCAGGTGCCCGGGGGAGCCCTGG - Intronic
1122804540 14:104249925-104249947 CTTGGTGCCAGGGAGGTGCCAGG - Intergenic
1124240337 15:28023096-28023118 CTTGGGGACCAGGGGAGACCTGG + Intronic
1125505668 15:40266254-40266276 ATTGGTGCCCGTGGGGGGCGAGG - Exonic
1128582476 15:68819249-68819271 CTTGGCCCCTTGGGGGGACCGGG - Intronic
1129450811 15:75650188-75650210 CCTGGTGCTCGGTGGGGATCTGG - Exonic
1130997535 15:88912306-88912328 CATGGTGGCCGGGGAGGGCCAGG + Intronic
1132554033 16:564863-564885 GTTGGGGCCCGCGGGGGGCCTGG + Exonic
1132596133 16:751152-751174 CCTGGTTCCCGTGAGGGACCTGG + Intronic
1133058899 16:3161621-3161643 CATGGTGCCAGGAGGGGAACAGG - Intergenic
1137559627 16:49494370-49494392 CTTGATGCCCCAAGGGGACCAGG + Intronic
1139359013 16:66385083-66385105 CTTGGTGCCTGGGAGGTGCCAGG - Intronic
1142113634 16:88345160-88345182 CTGGGTGCCCGGGAGGGGGCTGG - Intergenic
1142596151 17:1031059-1031081 CCTGGTGCCCGGCGGGCACTGGG + Intronic
1144770281 17:17755765-17755787 CTGGGTGCCAGGGGAGGAGCTGG - Intronic
1145303640 17:21657232-21657254 CTTGGTGCCGGAGGGGTCCCAGG - Intergenic
1145346404 17:22044617-22044639 CTTGGTGCCGGAGGGGTCCCAGG + Intergenic
1146602372 17:34229017-34229039 CTTGGTGGACGGGGGGAAGCCGG - Intergenic
1146970138 17:37065740-37065762 CTTGGTGTCCAGGGTGGTCCGGG + Intergenic
1147393361 17:40122920-40122942 CTTGGTGGCCGGGGGCGGACAGG - Intronic
1148029224 17:44608401-44608423 CTTGTTCCCCGGGAGGGGCCAGG - Intergenic
1148214639 17:45827758-45827780 CTTGGTGGCCGGGCGGAACTGGG + Intronic
1148997495 17:51723903-51723925 CTGGGTGCCCATGGGGTACCTGG + Intronic
1150791687 17:68205012-68205034 CTTGGGGCGGGGGGGGGACAGGG - Intergenic
1151894304 17:76969687-76969709 CTTGGTGCAGAGGGGGCACCAGG - Intergenic
1152727986 17:81957059-81957081 CTTGCAGCGCGGGGGGCACCGGG - Exonic
1156476392 18:37408484-37408506 GTTGGTGCCGGGGGGGGGCGCGG + Intronic
1157478989 18:48040708-48040730 CATGGAGCCTGGGGGGGACGGGG - Exonic
1159587010 18:70290622-70290644 CTTGGTGCCTTGGAGGAACCTGG + Intronic
1160943252 19:1629876-1629898 CTTGGTGACCCGGGGGGACATGG + Intronic
1160967570 19:1753380-1753402 CTTGGTGCTCGAGTGGGGCCGGG + Exonic
1161317437 19:3624227-3624249 CTGGGTGCCCGTGGGGGAGCAGG + Intronic
1161691112 19:5734846-5734868 ACTGGTGTCCGGGGAGGACCAGG + Intronic
1161703073 19:5805337-5805359 CGCGGTGCCCGGGGGGGGCCCGG - Intergenic
1163310240 19:16509995-16510017 CTTGGGGCCCGTGGGGGCCGGGG + Intronic
1163318176 19:16555644-16555666 CTTGGTGCCCTTTGGGGACCTGG - Intronic
1163469022 19:17486293-17486315 CTTGGTGGCCCTGGGGGAGCTGG - Intronic
1165159803 19:33809442-33809464 GTTGAGGCCCGGGGTGGACCAGG + Intronic
1167490740 19:49791640-49791662 CTGGGTGCCCATGGGGTACCAGG - Intronic
1167632334 19:50632701-50632723 CTGGGTGCCCTGGCGGGACAAGG - Exonic
1167829563 19:52008329-52008351 GCTGGTGACCGGGGGTGACCGGG + Intergenic
1168155326 19:54471179-54471201 CGTGGAGCCCGGGGAGGCCCGGG + Intronic
925048833 2:795682-795704 CTGGGGGCCCTGGGGGGAGCTGG + Intergenic
925160292 2:1678700-1678722 CTCGGTGCTCAGGGGGGCCCAGG - Intronic
926290713 2:11527535-11527557 CTTGGTCCCAGAGTGGGACCTGG + Intergenic
927956573 2:27211636-27211658 CTAGGTGCCCGGGGCGATCCAGG + Intronic
932564393 2:72896445-72896467 CTCGGTGCCCCAGAGGGACCTGG - Intergenic
936525930 2:113241726-113241748 CTTCCTTCCCGGGGGGTACCAGG - Exonic
937128414 2:119489048-119489070 CTGGGTGCCCAGAGGGGAGCAGG + Intronic
937361249 2:121231581-121231603 CTGGGTGCCCGGTGGGAGCCAGG - Intronic
938236157 2:129708712-129708734 CTGGGAGCCTGGAGGGGACCAGG + Intergenic
938298272 2:130192079-130192101 AGTGGTCCCCGGGGGAGACCTGG - Exonic
938458495 2:131482578-131482600 AGTGGTCCCCGGGGGAGACCTGG + Exonic
944685414 2:202113236-202113258 GTGTGTGCCCGCGGGGGACCAGG + Intronic
946366194 2:219250594-219250616 TGTGGTGCCTGGGGGTGACCTGG - Exonic
948382982 2:237563978-237564000 CTTGGTGCCCTGGGAGGGCAGGG - Intergenic
948858296 2:240740828-240740850 CCTGGTGCCCTGGGGGCAGCTGG - Intronic
1168916395 20:1491609-1491631 CTAGGTGCCCGGGAGGGAGGTGG + Intergenic
1169194205 20:3674627-3674649 CTTGGAGCCCCGGGGTGGCCAGG + Exonic
1171034954 20:21706927-21706949 CTTGGCGCCCGTGGGCGACACGG - Exonic
1172094272 20:32453034-32453056 CATGGGGCCCGTGGGGGCCCTGG + Intronic
1174506937 20:51023082-51023104 CTCGGAGCCCGGCGGGGACCGGG - Exonic
1174559218 20:51417936-51417958 CCTGGTACCCGCGGGGCACCGGG + Intronic
1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG + Intronic
1175820658 20:61907184-61907206 CCTGGTGCCCGGGGGGGCCTGGG - Intronic
1175933568 20:62504892-62504914 CTTGGTGCCAGGTGGGGGCTTGG + Intergenic
1176092586 20:63325664-63325686 CCTGGTGGCCGGGGTGGCCCTGG - Exonic
1180077826 21:45472146-45472168 CTTGGTGTCGGGGAGGGACTGGG - Intronic
1180167761 21:46038839-46038861 CTTTGTGCCAGGTGGGCACCCGG + Intergenic
1180751973 22:18130869-18130891 CGTGGTCCCCGGGGGAGACCTGG + Exonic
1180786269 22:18549444-18549466 CATGGTGCCCGGGAGACACCTGG + Intergenic
1181131551 22:20735171-20735193 CATGGTGCCCGGGAGACACCTGG + Intronic
1181243191 22:21488998-21489020 CATGGTGCCCGGGAGACACCTGG + Intergenic
1182094005 22:27614227-27614249 CTTGGAGACCGGGGGGGGGCGGG + Intergenic
1182359895 22:29740291-29740313 CTTGGTGCCAAGTGGGGACTGGG + Intronic
1182551960 22:31105387-31105409 CTCTGTGCCCGGGAGGGGCCAGG + Intronic
1182774484 22:32820673-32820695 CTTGGTGCCTGGGGGTAATCAGG - Intronic
1184604312 22:45563410-45563432 CTTGTTACCCGGGGGTGAGCTGG + Intronic
1184713637 22:46268094-46268116 CCCGGGGCCCGAGGGGGACCTGG - Intronic
1184787235 22:46677812-46677834 CTTGGTGCCGGGCTGGGGCCGGG + Exonic
1185300159 22:50075345-50075367 CTTGGGGGCCGGAAGGGACCTGG + Intronic
949552426 3:5122345-5122367 CTTGGTGCCCCGGCGCGACACGG - Exonic
953027027 3:39151408-39151430 CTTGGTGCCCAGGGGTGAGGTGG - Intronic
956757059 3:72399073-72399095 TTTGGTACCCGTGGGGGTCCTGG - Intronic
961779935 3:129315473-129315495 CTTTGTGCGCGGTGGGGGCCGGG + Exonic
961937372 3:130599772-130599794 CCTGGTGTCCCGGGGGGGCCTGG - Exonic
968008765 3:195259883-195259905 CTGGGGCCCCGGGGAGGACCAGG + Intronic
968053366 3:195672123-195672145 TTTGGTGTCCGTGGGGGTCCTGG + Intergenic
968102446 3:195976239-195976261 TTTGGTGTCCGTGGGGGTCCTGG - Intergenic
968531212 4:1092722-1092744 CTTGGGGCCCTGGGCTGACCTGG - Intronic
968533488 4:1109393-1109415 CTTGGAGCCCAGGGCTGACCAGG + Intronic
969214495 4:5711283-5711305 CTTGGAGCCCGGGCGGGCCAGGG - Exonic
977296276 4:95212959-95212981 CTTGGTGCCTGGGTGGGCCCTGG - Intronic
979544024 4:121919515-121919537 CTTGGTGCCTGGGGAAGACCAGG + Intronic
979763445 4:124435991-124436013 TGTGGTGCCTGGGGGTGACCTGG - Intergenic
980580819 4:134747543-134747565 CTTGGTGTCTGTGAGGGACCCGG + Intergenic
990592489 5:57280486-57280508 CTTGGTATCCGTGGGGGTCCTGG - Intergenic
992091039 5:73317206-73317228 CTAGGTGCCCATGGGAGACCTGG - Intergenic
992391799 5:76336593-76336615 CTTGGTGCTCGGTGGTGCCCAGG - Intronic
997207903 5:132060742-132060764 CTTGGAGTCCGGGGCGGACCAGG - Exonic
1001448349 5:171805273-171805295 CTTGGTGCCGGGAGGCGTCCGGG - Intergenic
1001883759 5:175270016-175270038 CTTGGTGCCTGGGAGGGGGCTGG + Intergenic
1003942552 6:11043959-11043981 CGAGGTGCCGGGGCGGGACCGGG + Intronic
1006068946 6:31483149-31483171 CTTGCTGCCCTGGGGCGGCCAGG - Intergenic
1006095288 6:31652484-31652506 CTTGGGGACCTGGGGGGAGCCGG - Exonic
1006296520 6:33172350-33172372 CCTGGGGCCCCAGGGGGACCAGG + Exonic
1006386708 6:33734991-33735013 CTTGGAGACTGGGTGGGACCAGG + Intronic
1007633600 6:43285553-43285575 CTTAGGGCCCGTGGGGGACGCGG + Exonic
1008007163 6:46423043-46423065 CTTGGTTCCTGGGGAGGTCCAGG + Intronic
1011698253 6:89932583-89932605 CTGGGTGCCCAGGGGGGTCCGGG + Exonic
1013170695 6:107634586-107634608 CTTGGAGTCCCGGGGGGACAGGG - Exonic
1014336369 6:120141942-120141964 CTTGGTGTCCGTGAGGGGCCCGG + Intergenic
1015994808 6:138987428-138987450 CTTGGGGCCCGGCGGGGGGCTGG - Intronic
1018264525 6:162008321-162008343 CTTCGTGCCCCGGGGGCCCCAGG + Intronic
1018905647 6:168073908-168073930 CTTGCTGCCTGGGGAGGACAGGG - Intronic
1019335686 7:481525-481547 CTTGGTGCCTCTGGGGGGCCAGG + Intergenic
1019517935 7:1447855-1447877 CTTGGTGCCCGGGGGGGACCTGG + Intronic
1021911444 7:25389355-25389377 CTTGGAGGCCGCAGGGGACCTGG - Intergenic
1023435068 7:40134274-40134296 CTGGGACCCCGCGGGGGACCTGG + Exonic
1023867848 7:44247273-44247295 CTGTGTGGCCTGGGGGGACCAGG + Intronic
1032074779 7:128831201-128831223 CTGGGTGCCCCGGGGAGTCCAGG + Intronic
1035522233 8:284211-284233 CTGGGTGGCCTGGAGGGACCTGG - Intergenic
1042482314 8:69318022-69318044 CTTGCTGCCTGGGCAGGACCTGG + Intergenic
1042740098 8:72033481-72033503 CTTGGTGCCTGGGGAGCACCAGG - Intronic
1042755767 8:72208833-72208855 TTTGGTGCCTGGGGAGCACCAGG - Intergenic
1043873885 8:85463940-85463962 CTTCGTGCTCGGGGGCGGCCCGG - Exonic
1044226042 8:89719282-89719304 CTTGGTGCCAGGGTGGGAGTGGG + Intergenic
1044430394 8:92101831-92101853 CCTCTTTCCCGGGGGGGACCTGG - Intronic
1045815192 8:106270404-106270426 CTTGGCGCCCGGGGGAGTCCAGG + Intronic
1050091267 9:2017476-2017498 CCTGGAGCCCGGGGAGGACAAGG + Intronic
1060031909 9:120221952-120221974 CTTGGTCCCAGAGGGGCACCTGG - Intergenic
1060399797 9:123341776-123341798 ATTGGTGCACGGTGGGAACCGGG + Intergenic
1060549118 9:124476865-124476887 CTGGGGGCCTGGCGGGGACCAGG + Intronic
1060920655 9:127418174-127418196 CCTGGTCCCCGGGGGGCATCAGG - Intergenic
1061118476 9:128628994-128629016 CCTGGTGCCCGGCGGGTACCTGG - Intronic
1062482517 9:136759183-136759205 CCCGGTGCCGGGGGGGGAGCTGG - Intergenic
1062543496 9:137051824-137051846 CTTGGTCTCCGGGTGGCACCTGG - Intronic
1186340440 X:8640094-8640116 GATGGTGCCCGGAGGGGACTGGG - Intronic
1193675501 X:84447581-84447603 CTTGGTGTGTGGGGGGGACCTGG - Intronic
1199357556 X:146879492-146879514 CTTGGTATCCGAGGGGGTCCTGG + Intergenic
1199542210 X:148969437-148969459 TTTGGTGTCCGAGGGGGTCCTGG - Intronic
1200034474 X:153318938-153318960 CTATTTGCCCGGGGGGGACTTGG + Intergenic