ID: 1019518251

View in Genome Browser
Species Human (GRCh38)
Location 7:1448973-1448995
Sequence ACCAGGCCGGTGGGCGCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019518241_1019518251 25 Left 1019518241 7:1448925-1448947 CCATCATTGCAGCGGGGATCACG 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1019518251 7:1448973-1448995 ACCAGGCCGGTGGGCGCTCAAGG No data
1019518246_1019518251 -1 Left 1019518246 7:1448951-1448973 CCATCTGCACAGGACTGAGGTCA 0: 1
1: 0
2: 1
3: 21
4: 211
Right 1019518251 7:1448973-1448995 ACCAGGCCGGTGGGCGCTCAAGG No data
1019518245_1019518251 0 Left 1019518245 7:1448950-1448972 CCCATCTGCACAGGACTGAGGTC 0: 1
1: 0
2: 1
3: 15
4: 157
Right 1019518251 7:1448973-1448995 ACCAGGCCGGTGGGCGCTCAAGG No data
1019518240_1019518251 26 Left 1019518240 7:1448924-1448946 CCCATCATTGCAGCGGGGATCAC 0: 1
1: 0
2: 0
3: 3
4: 36
Right 1019518251 7:1448973-1448995 ACCAGGCCGGTGGGCGCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019518251 Original CRISPR ACCAGGCCGGTGGGCGCTCA AGG Intronic
No off target data available for this crispr