ID: 1019519103

View in Genome Browser
Species Human (GRCh38)
Location 7:1452660-1452682
Sequence CTGTGGGTCTGGGGGTGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 704
Summary {0: 1, 1: 0, 2: 9, 3: 52, 4: 642}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019519103_1019519114 25 Left 1019519103 7:1452660-1452682 CCATCTCACCCCCAGACCCACAG 0: 1
1: 0
2: 9
3: 52
4: 642
Right 1019519114 7:1452708-1452730 TCAGAGCACCCCAGGCCCTCTGG 0: 1
1: 0
2: 1
3: 29
4: 282
1019519103_1019519111 -2 Left 1019519103 7:1452660-1452682 CCATCTCACCCCCAGACCCACAG 0: 1
1: 0
2: 9
3: 52
4: 642
Right 1019519111 7:1452681-1452703 AGTCAGGCTCTCAGAGCTCCAGG 0: 1
1: 0
2: 2
3: 23
4: 253
1019519103_1019519113 17 Left 1019519103 7:1452660-1452682 CCATCTCACCCCCAGACCCACAG 0: 1
1: 0
2: 9
3: 52
4: 642
Right 1019519113 7:1452700-1452722 CAGGCAGATCAGAGCACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019519103 Original CRISPR CTGTGGGTCTGGGGGTGAGA TGG (reversed) Intronic
900120496 1:1046722-1046744 GGGTGGCTCTGGGGGTGAGCAGG + Exonic
900183781 1:1323944-1323966 CTGAGGGTCTGGGGGTCTGCTGG + Intronic
900416051 1:2535153-2535175 CTGGGGGGCTGGGGGCAAGAGGG + Intergenic
900786404 1:4653273-4653295 CTGGAGGCCTGGGGGTGAAAGGG + Intergenic
900868011 1:5282601-5282623 CTGTGGGTCTGTGGGTCTGTGGG + Intergenic
900976255 1:6018432-6018454 GTGGGGCTCTGGGGGTGATAAGG + Intronic
901012790 1:6210694-6210716 CTGTGGATTTGGGGATGGGATGG + Intronic
901210860 1:7525274-7525296 GTGTGTGTAGGGGGGTGAGATGG - Intronic
901813766 1:11782336-11782358 GGGTGGGCCTGGGGGTGGGAGGG + Intronic
902077023 1:13795469-13795491 CTGTGGATCTAGGCGTGAGGAGG + Intronic
902122890 1:14182984-14183006 CTGTGGGTATGGAACTGAGAGGG - Intergenic
902466174 1:16620104-16620126 CTGAGGGTATGGGGGCCAGATGG - Intergenic
902508516 1:16953199-16953221 CTGAGGGTATGGGGGCCAGATGG + Intronic
902551875 1:17224183-17224205 CTGTGGTTCTGGGAGTTGGAGGG - Intronic
903278354 1:22235997-22236019 CGGTGGGTGTCTGGGTGAGAGGG + Intergenic
903575136 1:24335178-24335200 CTGTGGGTCTTCAGGGGAGAGGG - Intronic
903668261 1:25021160-25021182 CTGTAGGTCCTGGGGTGAGGGGG - Intergenic
903771590 1:25767724-25767746 GTGTGGGTCTGTGTGTGTGAGGG - Intronic
903795710 1:25927548-25927570 CTGTGAGTCTGGGAGTCAGGGGG + Intergenic
903852834 1:26318477-26318499 CTGTGGTTATGGAGGTGACAGGG + Intronic
904205984 1:28855541-28855563 CTGTGGGTGGAGGGGAGAGAGGG + Intronic
904374729 1:30073276-30073298 GTGTGGGCCTTGGGGTGAGGTGG + Intergenic
904449297 1:30600728-30600750 CTCGGGGTCTGGGGAAGAGAGGG - Intergenic
904480055 1:30787912-30787934 GTGTGGGTCAGGGAGAGAGAAGG - Intergenic
904517165 1:31065513-31065535 GAGTGGTTGTGGGGGTGAGAAGG - Intronic
904614684 1:31743354-31743376 CTCTGGGTCTAGGGGTGGGTGGG - Intronic
904670161 1:32158665-32158687 GTGGGGGACTGGGGGTGGGATGG - Intronic
904687685 1:32272758-32272780 CTGTGTGTGTGGGGGTGTGTGGG + Intronic
905179073 1:36155767-36155789 CTCTGGCACTGGGGCTGAGAGGG - Intronic
905209982 1:36367357-36367379 CTGTGGGCCTCAGTGTGAGAGGG + Intronic
905246362 1:36617087-36617109 CTGTGTCTATGGGTGTGAGACGG + Intergenic
905304676 1:37009396-37009418 ATCTGGGGCTGGGGGTGTGAGGG - Intronic
905348612 1:37328711-37328733 CTGTGGGACTGGGGGTTGGGTGG - Intergenic
905435307 1:37951574-37951596 GTGTGGGGCTGGGGCTGTGAGGG - Intergenic
905892598 1:41526636-41526658 GTGTGAGTGTGGGGGTGTGAGGG - Intronic
905892929 1:41528419-41528441 ATGTGAGTCTGAGGGTGTGAGGG - Intronic
906143510 1:43547091-43547113 CTGGGGGCCTGGGGGTGGGAGGG - Intronic
906509272 1:46401561-46401583 CTGTGGGTGTGGGGATGGCATGG + Intronic
906795002 1:48689684-48689706 CTGTGTGTGTTGGGATGAGATGG + Intronic
907044363 1:51290775-51290797 CTGTGGGTCTGAGGGGGTTATGG + Intronic
907121596 1:52012798-52012820 CATTGGGGATGGGGGTGAGAAGG - Intergenic
908398174 1:63745463-63745485 CTGTGGGGCTGGGTGAGAGTGGG - Intergenic
908581831 1:65525264-65525286 CTGGAAGTCTGGGGGTGGGAGGG + Intronic
911102454 1:94105408-94105430 CTGTGGCTCTGGGGGGGAAGGGG + Intronic
912922029 1:113877959-113877981 CTGTGGGTATGGAATTGAGAAGG + Intergenic
912935871 1:114003234-114003256 CTGTGGGTCTGGGGCAGGGAAGG + Intergenic
913155283 1:116091561-116091583 GTGTGTGTCTGGGTGTGGGATGG - Intergenic
915598345 1:156907829-156907851 CTGTGGTTATGGGGGTGTCAAGG + Intronic
915603085 1:156934719-156934741 ATCTGGGTCTGGGGGTGAGAGGG + Intergenic
915669066 1:157472200-157472222 CTGTGTGTCTGGGAGTGACGTGG - Intergenic
915887658 1:159740473-159740495 CAGAGGGTCTGGGGATAAGATGG + Intergenic
916058696 1:161084827-161084849 GTGTGGGTTTGGGGGGGTGAGGG + Intronic
916493807 1:165326930-165326952 GTGTGTGTCTGGGGGTGAGGGGG - Intronic
916608011 1:166362170-166362192 CTGGGGATCTGAGGGTTAGATGG - Intergenic
917720197 1:177779792-177779814 ATGGGTGTCCGGGGGTGAGAGGG - Intergenic
917797314 1:178541751-178541773 CTGTTGGCCTGGGGTGGAGAGGG + Intronic
918147043 1:181766120-181766142 CTTTGGGTATGGGAGTGGGAGGG + Intronic
918304211 1:183231118-183231140 CTGTGGGGTTGGGGGTGGTAAGG - Intronic
918372078 1:183870574-183870596 CTTTGGGACTGGGCCTGAGAAGG + Intronic
918989893 1:191684938-191684960 CTGTGGGCCTGTGGGGGTGATGG - Intergenic
920412607 1:205774295-205774317 TTGTGGGGCTGTGGGTGGGATGG - Intronic
920451174 1:206062351-206062373 CTCTGGGGCTGGGGGTGATCTGG - Intronic
921285408 1:213604835-213604857 CTGTGGGTCTGGGGAAGGGTGGG + Intergenic
921956973 1:220994884-220994906 CTGTGGATGTGGTGGGGAGAAGG + Intergenic
922291166 1:224210088-224210110 CTGTGGGTCTTGGGGTCTGTGGG - Intergenic
922685499 1:227635818-227635840 CCGTGGGACTGGGCCTGAGAAGG + Intronic
923000795 1:230004963-230004985 CTGCGGGGTTGGGGGTGTGAGGG + Intergenic
923093916 1:230760087-230760109 CTGAGGGTCTGCGGGTCACACGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924085920 1:240451501-240451523 CAGTGGTTCTGGGGATGAGCTGG + Intronic
924139756 1:241010038-241010060 GTGTGGGGCTGGGGGAGGGATGG + Intronic
924199623 1:241645507-241645529 CTGTGAGGGTGGAGGTGAGAAGG + Intronic
924719353 1:246607746-246607768 CTTTGGGACTGGGCCTGAGAAGG + Intronic
924821338 1:247493550-247493572 ATGTGGGTTGGGGGGTGAGGTGG + Intergenic
924954562 1:248914233-248914255 TTGAGAGTCTGGGGGTGAGCTGG + Intronic
1062771240 10:103284-103306 GCGTGGGGCTGGGGGTGAGGGGG - Intergenic
1063174670 10:3540592-3540614 CTGTGTGTGTGGGGGAGAGTGGG - Intergenic
1063375806 10:5553636-5553658 CTGTGGGGCTGGGAGGGAGGAGG - Intergenic
1064282754 10:13966569-13966591 CCATGGTTCTGGGAGTGAGATGG + Intronic
1064374768 10:14785433-14785455 CTGGAGGTCTGGGGGTGTGGGGG + Intergenic
1065393432 10:25208501-25208523 CCGTGGTTCTGGTGATGAGATGG - Intronic
1065917354 10:30364922-30364944 CTGTGGGGGTGGGGGTGGGGTGG - Intronic
1066620603 10:37345258-37345280 CAGTGGGGCTGGGCATGAGAGGG - Intronic
1066623860 10:37385789-37385811 CAGTGGGGCTGGGCATGAGAGGG - Intergenic
1066746283 10:38605631-38605653 CTGCGGGTCTTGGGGAGAGATGG + Intergenic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1067088254 10:43254031-43254053 CTGTGGGCCTGAGGGTGGGGAGG - Intronic
1067724880 10:48762511-48762533 CTGTGGGTCAGGGATTCAGAAGG + Intronic
1068103842 10:52590333-52590355 CTCTGGGGCTGGGGGTGGGGTGG + Intergenic
1068865631 10:61892713-61892735 CTGTGTGTCTGTGTGTGTGATGG - Intergenic
1069735628 10:70652206-70652228 CTGTGGGACCGGGAGTGTGAGGG + Intergenic
1069802970 10:71093689-71093711 CTGTGGGTCTGGGCCTGACCTGG + Intergenic
1069851704 10:71409545-71409567 CTGCTGGCCTGGGGGTGGGATGG + Intronic
1070322035 10:75361841-75361863 CTGTGTGCCTGGGCGTGGGAAGG + Intergenic
1072451574 10:95543183-95543205 ATGTGGGTTGGGGGGTGAGCTGG - Intronic
1072490993 10:95906012-95906034 CTCTGGGTCCTGGGGTGGGATGG + Intronic
1073184350 10:101606812-101606834 CTGGGGGAATGGGTGTGAGAAGG + Intronic
1073449075 10:103598884-103598906 CTGTGAGTTAGGGGGTGAGGGGG + Exonic
1073943142 10:108720298-108720320 CTGTGGGTCTGAGGATGTGGAGG - Intergenic
1074850181 10:117433126-117433148 CTTTGGTTTAGGGGGTGAGAAGG + Intergenic
1074949239 10:118312893-118312915 CTGTGGGGCTGGGGAGGAGTTGG + Intronic
1074986491 10:118664379-118664401 CTGGGGTTCTGGGGGTAGGATGG + Intergenic
1075646385 10:124099567-124099589 CTGTGGGTGTGGGTGAGAGCTGG + Intergenic
1076497085 10:130904451-130904473 CTCTGGGTTTGGGGGTGCTAGGG - Intergenic
1076653565 10:132006306-132006328 GGGTGGGTGTGGGGGTGGGAGGG + Intergenic
1076909107 10:133378759-133378781 CAGTGGGTCTGGGGGTGCCACGG - Intergenic
1077077745 11:708992-709014 CTGTGGGGAGGGGGGTGGGATGG - Intronic
1077094513 11:793620-793642 CTGTGGGGCAGGGGGTCAGCTGG + Intronic
1077098722 11:811521-811543 CTGTGACTCTGGGAGGGAGAGGG + Intronic
1077575585 11:3380554-3380576 CTCTGCTTCTGGGGATGAGATGG + Intergenic
1077616274 11:3676285-3676307 CTGAGGGTCTGGTGTTGAGTCGG + Exonic
1077660012 11:4059395-4059417 CTGTGAGTCTTGTGTTGAGAAGG + Exonic
1078602115 11:12742422-12742444 CAGAGGTTTTGGGGGTGAGAGGG + Intronic
1078986359 11:16603519-16603541 CTTTGGGAGTGGGGGTGGGAGGG + Intronic
1081568650 11:44276096-44276118 CAGTGGGGCTTGGGGTGAGGAGG + Intronic
1081577515 11:44328371-44328393 CTCTGGGCCTGGGGGAGAGGAGG - Intergenic
1082625029 11:55473965-55473987 CTGTGGGTCCTGGGGTGACTCGG - Intergenic
1082888643 11:58114558-58114580 CATTGGGTCTGGGGATGAAAAGG + Intronic
1083009983 11:59387801-59387823 GTGTGGTTTTGAGGGTGAGAGGG + Intergenic
1083266983 11:61551301-61551323 CTGTGGGGCTGGGGGAGAGAAGG + Intronic
1083293915 11:61705099-61705121 CTGTTGCTCTGAGGGTGGGATGG + Intronic
1083419316 11:62544490-62544512 CTGTGGGAATGTGGGTTAGAGGG - Intronic
1083493551 11:63030919-63030941 CTGGGGGGCTGTGGGGGAGACGG + Intergenic
1083681604 11:64354169-64354191 AGGTGGGTCTGGGGGTCAGGTGG + Exonic
1083808788 11:65090715-65090737 CTGTGGGTCTTGGGCTGACCTGG - Intronic
1083893175 11:65607058-65607080 ATGTCGGTCTGGGAGTGGGAAGG - Intronic
1083998855 11:66285164-66285186 CTGCGAGTCTTGGGGAGAGAAGG - Intronic
1084431765 11:69115314-69115336 CTGTGGGTCAGGGGGATGGAGGG + Intergenic
1084610862 11:70202281-70202303 CCGTGGGTCTGGAGGTGAGGAGG - Intergenic
1084857356 11:71997679-71997701 CTGAGGGTCTGGGGGTGGTTGGG + Intergenic
1084889080 11:72227956-72227978 GTGTAGGTCTGGTGGGGAGACGG + Intronic
1085534830 11:77211596-77211618 CTGCCTGCCTGGGGGTGAGAAGG + Intronic
1086516725 11:87622041-87622063 CTGTGTCTCTGCAGGTGAGATGG + Intergenic
1086929042 11:92672217-92672239 GAGTAGGTCTGGGGATGAGAAGG - Intronic
1088389158 11:109294684-109294706 GTGTGGGTATGTGTGTGAGAGGG + Intergenic
1088985875 11:114907806-114907828 CTCTGCTTCTGGGGGTTAGATGG + Intergenic
1089043335 11:115475077-115475099 CTGAGGATTTGGGTGTGAGAAGG - Intronic
1089736609 11:120554077-120554099 CTGTGGGTGGGGGTGTGAGTGGG - Intronic
1090422842 11:126587459-126587481 CTGTGGGTTTGGGAATGTGATGG - Intronic
1090439561 11:126714447-126714469 CTGTGGGACAGCGGGTGTGATGG + Intronic
1090593245 11:128294062-128294084 CTGTGGTCCTTGCGGTGAGAGGG - Intergenic
1091202327 11:133791235-133791257 CAGTGTCTCTGCGGGTGAGAAGG - Intergenic
1091211366 11:133864159-133864181 CTGTGGGTCTGAGGGTCCTAGGG + Intergenic
1091307044 11:134542940-134542962 CTGTGGGTCAGAGGGTAAGGGGG + Intergenic
1091881157 12:3979299-3979321 CTGTGAGTTTGGGGGTGGGGAGG + Intergenic
1091949490 12:4581075-4581097 CTTTGGGTCTTGGTGTGAGAGGG + Intronic
1092060805 12:5548887-5548909 GTGTGGGTCTGGGGTTGGAAGGG - Intronic
1092193715 12:6536897-6536919 CTATGGGGGTGGGGGGGAGATGG - Intronic
1093728662 12:22543978-22544000 CTGAGGGGCTGGGGGCGAGGTGG + Intronic
1094469621 12:30791648-30791670 CTGAGGGCATTGGGGTGAGATGG - Intergenic
1094709617 12:32948439-32948461 CTGATGTACTGGGGGTGAGATGG + Intergenic
1095169745 12:39020097-39020119 CTGTGGGCCTGGGGTGGTGATGG + Intergenic
1095224852 12:39667954-39667976 GTGTGTCTCTGCGGGTGAGATGG + Intronic
1095870745 12:47025321-47025343 CTGAGGGTTTGGGGGAGGGAGGG - Intergenic
1096181733 12:49554849-49554871 CTGGGGGTCAGGGGCTGAGCAGG + Intronic
1096358884 12:50966503-50966525 CTGAGGGTGTGGAGGTGGGAAGG - Intronic
1096981476 12:55730006-55730028 CTGGAGGTGTGGGGGTGTGACGG - Intergenic
1097161089 12:57047248-57047270 CAGTGATTCTGGGGGTTAGATGG + Intronic
1098355995 12:69613087-69613109 CTGAGGGTTTGTGGGTGATAGGG + Intergenic
1100271454 12:93029237-93029259 CTGGAGCCCTGGGGGTGAGAGGG - Intergenic
1100891597 12:99132029-99132051 CTGCTGGCCTGGGGGTGGGAAGG - Intronic
1101490907 12:105208443-105208465 CTGAGGGTCTGTGAGGGAGAGGG + Intronic
1102471243 12:113161088-113161110 CTGTGGGTGTGGGGGTTGGGTGG + Intronic
1102497488 12:113329624-113329646 CTCTGCGTCTGGGGGAGGGAAGG + Intronic
1102511830 12:113421226-113421248 CAGTGGGGCTGGGAGGGAGAAGG - Intronic
1102583875 12:113909735-113909757 AAGTGGGTCTGGAGGTGAGAAGG - Intronic
1102880581 12:116481900-116481922 GTGGGGGTCAGGGGGTGGGATGG - Intergenic
1102952983 12:117042357-117042379 CTGGGGGGCTGGTGGTGAGGTGG - Intronic
1103136190 12:118509934-118509956 CTGTTGGACTTGGGCTGAGAGGG + Intergenic
1103328490 12:120137569-120137591 CTGTGGTTCTGGAGGAGAGCTGG - Exonic
1103413760 12:120730694-120730716 CTGTGTTTCTGGGGATGAGATGG + Intronic
1103446708 12:120999605-120999627 CTGTGGGGCTGGCGCTGAGCCGG - Exonic
1103736782 12:123065683-123065705 CTGTGGGTGTGAGGATGAGGAGG + Intronic
1103950637 12:124549262-124549284 CTGAGGGGCTGGCGGTGGGAGGG + Intronic
1103966953 12:124646102-124646124 ATGTGGGGCTGGGGGGGAGGGGG + Intergenic
1104198782 12:126567309-126567331 CTGTGGGGCAGGGGGTGGGTGGG - Intergenic
1104204141 12:126620140-126620162 AAGTGGGTGTGGGGGTGAGGGGG + Intergenic
1104476270 12:129073009-129073031 CTGTGGGTGGGGGAGGGAGAGGG - Exonic
1104595332 12:130116718-130116740 CTGGGGGTCTGGGAGTTTGACGG + Intergenic
1104729180 12:131095552-131095574 CTGTGGGGCTGAGGGTGGGCCGG + Intronic
1104761504 12:131299777-131299799 CTGAGGGGCTGCGGGTGGGAAGG + Intergenic
1104787561 12:131459437-131459459 CCGTGGGTGGGTGGGTGAGAAGG - Intergenic
1104818272 12:131661015-131661037 CTGAGGGGCTGCGGGTGGGAAGG - Intergenic
1104965698 12:132507992-132508014 CTGTGGGACGGGGGATGGGAGGG - Intronic
1104970936 12:132530415-132530437 CTGTGGGTCAGGGGGAGGGCCGG + Intronic
1105624714 13:22101623-22101645 CTGTAGTTCTGGGGGTTCGAGGG - Intergenic
1105700895 13:22935223-22935245 CTGTGGGGCTTGGGGTGGGTGGG - Intergenic
1105853717 13:24358280-24358302 CTGTGGGGCTTGGGGTGGGTGGG - Intergenic
1105874538 13:24540816-24540838 CTGTGGCTCTGAGGCTGAGCCGG + Intergenic
1105898303 13:24736551-24736573 CTCTGCTTCTGGGGGTGAGTTGG - Intergenic
1106411416 13:29514037-29514059 CTGGGTGTCTGGGGCTGAGCGGG + Exonic
1107611784 13:42121665-42121687 CTATGGGTGTAGTGGTGAGAAGG - Intronic
1108268869 13:48738997-48739019 ATGTGGGCCTGAGGGAGAGAGGG - Intergenic
1109747696 13:66647926-66647948 CTGTGGGCCTGGGGAAGAGACGG + Intronic
1110429276 13:75404987-75405009 ATGTGGGCCAGGGGTTGAGAAGG + Intronic
1110735133 13:78927770-78927792 CTGTGGGTCTTGGGCAGATAGGG - Intergenic
1111433869 13:88180830-88180852 CTGAGGGTGTGGGGGTGTGATGG - Intergenic
1112419920 13:99239341-99239363 ATGTGTGTCCGGGGTTGAGAAGG - Intronic
1113207917 13:107940103-107940125 CAGTGGGTCTGGTGGTGATTTGG + Intergenic
1113333192 13:109352033-109352055 GTGTGTGTGTGGAGGTGAGAGGG + Intergenic
1113682649 13:112255095-112255117 CTGTGGGACTGGTGGGGAGATGG + Intergenic
1114560783 14:23589042-23589064 CTGTGGGGGTGGAGGTGGGAGGG + Intergenic
1114769887 14:25417015-25417037 CTCTGGGTCTGCTGGTGACACGG + Intergenic
1115394945 14:32897831-32897853 ATGTGGCTCTGGAAGTGAGAGGG + Intergenic
1115528867 14:34307535-34307557 ATGAGGGTCTGTGGTTGAGAAGG - Intronic
1115879532 14:37899537-37899559 CTGGGAGTCTGGGGCTGACATGG - Intronic
1116243199 14:42373744-42373766 TTGTGAGTCTGAGAGTGAGACGG - Intergenic
1117074787 14:52091046-52091068 CTGTGGGTCTGGGGTCAAGAGGG + Intergenic
1117535465 14:56698694-56698716 CCCTGGGGCTGGGAGTGAGATGG + Intronic
1118308182 14:64673593-64673615 CTGTGTCTCTAGGGGTGGGAAGG - Intergenic
1118375581 14:65174088-65174110 CTGAGTGTGTGGGGGTGTGATGG + Intergenic
1118473437 14:66095253-66095275 CTGGGGGTGTGGGGGTGTGGTGG + Intergenic
1119104053 14:71907404-71907426 CTGTGGGGCTGGGGCGTAGAAGG + Intergenic
1119182722 14:72615250-72615272 CTTTGGGTCTGTGTGTGAGGAGG - Intergenic
1120110638 14:80551410-80551432 CTGTAGGTCTGGGGTTTATATGG - Intronic
1120292589 14:82594308-82594330 CTTTGTTTCTGGGAGTGAGAGGG - Intergenic
1121122574 14:91385269-91385291 CCCTGGGTCTGGGGTAGAGATGG - Intronic
1121620653 14:95345854-95345876 GTGTGGGGCGGGGGGTGAGGGGG + Intergenic
1122378231 14:101283102-101283124 CTGGGGTTCAGGGGTTGAGAAGG + Intergenic
1122606074 14:102948287-102948309 GGGTGGGTGTGGAGGTGAGACGG + Intronic
1122606166 14:102948499-102948521 TGGTGGGTGTGGAGGTGAGAGGG + Intronic
1122606250 14:102948707-102948729 GGGTGGGTGTGGAGGTGAGAGGG + Intronic
1122631051 14:103107923-103107945 CTGTGGGGCTGGGGGGTGGAGGG + Intronic
1122726993 14:103762719-103762741 CGGTGGCCGTGGGGGTGAGACGG + Intronic
1122888593 14:104722604-104722626 CAGTGGGTCTGGGGGTGTCAAGG - Intergenic
1122967443 14:105137957-105137979 CCCTGGGTCTGGGGGTCTGATGG + Intergenic
1123034274 14:105465518-105465540 CTGAGGGTCTGGGGTTTAGGTGG + Intronic
1124121811 15:26894392-26894414 CAGTGGGTCCCCGGGTGAGATGG + Intronic
1124632499 15:31345570-31345592 CTGTGAGTATGAGGGTGGGACGG + Intronic
1124959098 15:34381927-34381949 CTGTGGGGGTGGGGGTGGGGTGG - Intronic
1124975724 15:34528148-34528170 CTGTGGGGGTGGGGGTGGGGTGG - Intronic
1125499776 15:40232358-40232380 CTGGTGGGCTGGGGCTGAGATGG + Intergenic
1126998362 15:54473005-54473027 ATGTGGGGGTGGGGGAGAGAGGG - Intronic
1127013413 15:54655537-54655559 TTGGGGGTCTGGGGATCAGACGG - Intergenic
1127395506 15:58541323-58541345 CTATGGGTTTAGGGGTGAGGTGG + Intronic
1127534214 15:59874859-59874881 CTGTGGCTCTGGTAGTCAGAGGG - Intergenic
1127921219 15:63495857-63495879 CTGTTGGCCTGGGGGTGGGGAGG - Intergenic
1127993022 15:64134641-64134663 CTGTGGGGGTGGGGTTGAGGAGG - Intronic
1128234585 15:66059014-66059036 CTAGGAGTCTGGGGGTGAGTAGG + Intronic
1128264430 15:66254251-66254273 GTGGGGGTCTGGGGGTTAAATGG + Intergenic
1128601435 15:68998503-68998525 CTGTGGGTGGTGGGGTGAGCTGG + Intronic
1129296772 15:74604167-74604189 CTGTGGGGCTGGAGGTGTGTGGG + Intronic
1130080018 15:80724691-80724713 CTGTGGGTCTGGGAGGGTGATGG + Intronic
1130879320 15:88041593-88041615 CTGAGGGACTGGGGCTGAGTGGG - Intronic
1131000911 15:88939237-88939259 CTTTGGGACTGGGCCTGAGAAGG + Intergenic
1131228114 15:90641800-90641822 CTGTGGGCCTGGGGGTGGTCAGG + Intronic
1132612863 16:825978-826000 CTGTGGGTTTGAGAGCGAGAGGG + Intergenic
1132619092 16:855944-855966 CTTTGGGTCTGGGTGTGTGATGG + Intronic
1132655890 16:1041527-1041549 CTGGGGGTCTGGGGAGGAGGTGG - Intergenic
1132732094 16:1367576-1367598 GTGAGCGTGTGGGGGTGAGATGG - Intronic
1132845389 16:1998845-1998867 GCCTGGGTCTGGGGGTCAGAAGG + Exonic
1132984410 16:2756793-2756815 CTGTGTGTCTGGGGCATAGATGG + Intronic
1133042413 16:3067674-3067696 GTGTGGGGCTCAGGGTGAGAAGG + Intronic
1133757061 16:8769689-8769711 CTGTGGGTCGGGGGATGCTATGG + Intronic
1134117623 16:11561083-11561105 AGGTGGGTCTGGGGCTGTGACGG - Intronic
1135304193 16:21354724-21354746 CTGTGGGCATGGGGGTGGGGAGG - Intergenic
1135496604 16:22956912-22956934 CTGTGGCTCCTGGGGAGAGAGGG + Intergenic
1135828131 16:25748443-25748465 CTGCAGGTGTGGGGGTGGGAAGG - Intronic
1136091764 16:27925750-27925772 CCGAGGGGCTGGGGGTGACAAGG + Intronic
1136300934 16:29333861-29333883 CTGTGGGCATGGGGGTGGGGAGG - Intergenic
1136736778 16:32474011-32474033 CTGCGGGTCTTGGGGTGAGATGG - Intergenic
1136922337 16:34343619-34343641 TTGTGGCTCTGGGGGTGACAAGG + Intergenic
1136982236 16:35068187-35068209 TTGTGGCTCTGGGGGTGACAAGG - Intergenic
1137360047 16:47805983-47806005 CTGTGAGGCTGGGGTTGAGTTGG + Intergenic
1137627825 16:49920787-49920809 CAGTGGGTCTTGTGCTGAGAAGG + Intergenic
1137687032 16:50393397-50393419 CTCTGGGGCTGGGGGTAAGAGGG - Intergenic
1137716637 16:50602140-50602162 CTGGGGGCCTGGGAATGAGAGGG + Intronic
1138264758 16:55652440-55652462 CGGTGAGTCTGGGCGAGAGATGG + Intergenic
1138870897 16:60883224-60883246 CTGTTGATCAGGGGGAGAGAAGG + Intergenic
1139198120 16:64944697-64944719 CTGGGTTTCTGGGGGTGACAGGG - Exonic
1139247916 16:65464345-65464367 GTGTGGGTCTGAGGGTATGAGGG - Intergenic
1139587272 16:67912012-67912034 CTGTGGGCCTAGGGGTGAAGGGG + Intronic
1139957501 16:70700158-70700180 CTTTGGGGCTGGGGGTGGGGAGG - Intronic
1140341074 16:74162847-74162869 CTGTGTGTGTGGTTGTGAGAGGG + Intergenic
1140684416 16:77419395-77419417 ATGGGGCTCTAGGGGTGAGAAGG - Intronic
1140901579 16:79372810-79372832 CAGTGGGTCTGGAGCTGAGAGGG - Intergenic
1141280427 16:82626224-82626246 CTTTGGGACTGAGGGTAAGAGGG - Intergenic
1141474666 16:84264745-84264767 CCTTGGGTCTGGGGGTAACAGGG - Intergenic
1141596722 16:85101454-85101476 CTGTGGGTCTGGGGTTGATGGGG - Intronic
1142062634 16:88040590-88040612 CTGTGGGCATGGGGGTGGGGAGG - Intronic
1142184384 16:88687440-88687462 CTGTGGGCCGGGGGTGGAGAAGG + Intergenic
1142396363 16:89833925-89833947 GTGTGGGTGTGGGTGTGAGCTGG + Intronic
1203016290 16_KI270728v1_random:355566-355588 CTGCGGGTCTTGGGGTGAGATGG + Intergenic
1203034625 16_KI270728v1_random:628724-628746 CTGCGGGTCTTGGGGTGAGATGG + Intergenic
1142502335 17:340060-340082 CAGTGGGTCTGGTGGGGAGCAGG - Intronic
1142722491 17:1786016-1786038 CCATGGGACTGAGGGTGAGAGGG - Intronic
1142736768 17:1905884-1905906 CTGTGTGTATGGGGGTGTGCTGG + Intergenic
1143644249 17:8219737-8219759 CTGTGTGGATGGTGGTGAGATGG + Intergenic
1144296989 17:13885676-13885698 CGATGGGTCAGGGGGTGAGATGG - Intergenic
1144511810 17:15883480-15883502 CTGTGGTTCTGGAGGAGAGGAGG + Intergenic
1145091270 17:19988054-19988076 CTGTTGGACTGGGGGTGGGGTGG - Intergenic
1145799064 17:27671903-27671925 CTCTGGGTCTGGTGCTGGGAAGG - Intergenic
1145826559 17:27881283-27881305 GTGTGGGGCTGGGAGTGACAGGG - Intronic
1146973665 17:37093021-37093043 CTATGGGCCTGGAGCTGAGATGG - Intronic
1147811787 17:43175776-43175798 CTGTGAGGCTAGGGTTGAGAAGG - Exonic
1147948769 17:44095509-44095531 CTGTGGGAATGGGGGTGGGGTGG + Intronic
1148105181 17:45115056-45115078 CTGGGTGTCTGGGGGCGAGAGGG - Intronic
1148235181 17:45964002-45964024 CTCTGGGTGAGGAGGTGAGAGGG + Intronic
1148852014 17:50560150-50560172 CTGCGGGACTGGGGGAGGGAAGG - Intergenic
1148948451 17:51286973-51286995 CTGTGGGTCGGGGGGGGAAGGGG - Intronic
1149725003 17:58884253-58884275 CTGTGGAACTGGGGGTAAGTTGG - Intronic
1149848659 17:60022115-60022137 GGGTGGGTTTGGGGGTGGGAAGG - Intergenic
1149861510 17:60124409-60124431 GGGTGGGTTTGGGGGTGGGAAGG + Intergenic
1150618225 17:66788871-66788893 CTGTGGGCCTGAGGGGGAGAGGG + Exonic
1151156220 17:72124316-72124338 CTGTGGGTCTGCGGGATGGAAGG - Exonic
1151260557 17:72912660-72912682 CTGAGGGTACGGGGGTGAGGAGG + Intronic
1151356370 17:73561018-73561040 CTGTGGGTAGTGGGGTGAGGAGG - Intronic
1151403396 17:73871040-73871062 CATTGGGTCTGGGGGTGGCAGGG - Intergenic
1151657866 17:75504087-75504109 CTGTGGGCCTCGGGGTGGGTAGG - Intronic
1151774895 17:76193896-76193918 CTGTGGATGTGGAGGTGGGAGGG - Intronic
1151793181 17:76322960-76322982 CTGCAGGTCTGGGTGAGAGAGGG + Intronic
1151855087 17:76715306-76715328 CTGTGGGCGTGGGGGTAAGGAGG + Exonic
1152016728 17:77755900-77755922 CTGTGGCTCTGGTGGGGACAGGG - Intergenic
1152325633 17:79634261-79634283 CAGTGGCTCTGGCGGTGAGGTGG - Intergenic
1152528400 17:80902719-80902741 ATGGGTGTCTGGGGGTGAGGAGG - Intronic
1152588302 17:81198901-81198923 CTGTGGTTCTGGGGATGAGTCGG + Exonic
1152681644 17:81671579-81671601 CTGTGGGTTTTGGGGTGGTAAGG + Intronic
1152754166 17:82080190-82080212 CTGTGAGGCTGAGGCTGAGACGG - Exonic
1152795511 17:82304321-82304343 CCCTGGGGCTGGGGGTGGGAAGG + Intergenic
1152848562 17:82617653-82617675 CTGTGTGTCTGGGAGAGGGAAGG + Intronic
1153660061 18:7318098-7318120 CTGTGGGCCTGGGAGACAGAAGG - Intergenic
1156435427 18:37122714-37122736 CTGTGAATCAGGAGGTGAGATGG + Intronic
1156622718 18:38872283-38872305 CAGGGGGTCTGGGGGTCAGGGGG - Intergenic
1156640236 18:39086272-39086294 TTGTGGGTGTGGAGGTGTGAAGG + Intergenic
1156760890 18:40588863-40588885 ATGTGAGTGTGGGGATGAGATGG - Intergenic
1157803956 18:50644298-50644320 CTGAGGGTCGGGGGATGGGAGGG + Intronic
1157918958 18:51696663-51696685 CTTTGGGACTGGGCCTGAGAAGG - Intergenic
1157959200 18:52133639-52133661 GTGGGGGTGGGGGGGTGAGAGGG + Intergenic
1158010514 18:52722391-52722413 CTGGGAGTCTGAGGATGAGAAGG - Intronic
1158309746 18:56145178-56145200 CTGTGGATCTGGGGTCAAGATGG - Intergenic
1158638311 18:59180439-59180461 CTGTTAGTCTGGAGCTGAGAGGG + Intergenic
1159775891 18:72602313-72602335 CTCTGGGTCTGGTGAGGAGAAGG + Intronic
1159997551 18:74980887-74980909 CAGTGTGTCTGGGGCTGAGAAGG - Intronic
1160338039 18:78060159-78060181 CTGAGGGTCTGGGGCTGAGTGGG - Intergenic
1160373077 18:78390557-78390579 CTGCGGGCCTGGGGGTGACATGG + Intergenic
1160420479 18:78740495-78740517 CTGTGGGTCAGGTGGCGTGAGGG + Intergenic
1160555695 18:79723545-79723567 CTGGGGACCTGGGGGTGAGTGGG + Intronic
1160827916 19:1089310-1089332 CTGGGGGTCTGGGGGTGTCCTGG + Intronic
1160828894 19:1093626-1093648 ATGGGGGGCTGGGGGTGAGTGGG + Intronic
1161186765 19:2926598-2926620 CTGTGGGTGTGGGGGACCGAGGG - Intergenic
1161482896 19:4519563-4519585 CTGTGTTATTGGGGGTGAGAGGG + Intergenic
1161644454 19:5444536-5444558 CTGTGGGGATGGGGGTGGCAGGG - Intergenic
1162239235 19:9335455-9335477 CTGGGGGTATGGGGGAGACAGGG - Intronic
1162754952 19:12852265-12852287 CAGGGGGACTGGGGGTGAGCAGG + Intronic
1163013683 19:14440917-14440939 CTGTGGTGGTGGGGGTGACAAGG + Intronic
1163350000 19:16770607-16770629 CTGTGGGGCAGGGGGAGGGATGG - Intronic
1163509021 19:17724459-17724481 GCGTGGGTCTGGAGGTGGGAAGG + Intronic
1164420750 19:28089886-28089908 CTGTGTCTCTGCAGGTGAGATGG - Intergenic
1165279924 19:34787038-34787060 CTGTGGGGCTGGGGCCCAGAGGG + Intergenic
1165317457 19:35065524-35065546 CTGTTGGCCTGGGGGTGTGCAGG - Exonic
1165353619 19:35290928-35290950 TTGTGGGGCTGGGGGGGAGTTGG - Intergenic
1166071365 19:40390055-40390077 CTGGGGGTTTGGGGGTGCCAGGG - Exonic
1167358153 19:49016493-49016515 CTGTGGGTCTGGCCCTGAGGTGG + Intronic
1167359648 19:49023383-49023405 CTGTGGGTCTGGCCCTGAGGTGG + Intronic
1167361483 19:49032702-49032724 CTGTGGGTCTGGCCCTGAGGTGG - Intronic
1167362171 19:49036083-49036105 CTGTGGGTCTGGCCCTGAGGTGG + Intronic
1167363913 19:49044775-49044797 CTGTGGGTCTGGCCCTGAGGTGG - Intronic
1167364585 19:49048152-49048174 CTGTGGGTCTGGCCCTGAGGTGG + Intronic
1167365870 19:49054788-49054810 CTGTGGGTCTGGCCCTGAGGTGG + Intronic
1167420014 19:49397315-49397337 CTGCTGGACTGGGGGTGACAGGG + Intronic
1167671562 19:50856491-50856513 CCTTGGGACTGGGGGAGAGAGGG + Intronic
925922142 2:8645309-8645331 CGGAGGGGCTGGGGGTCAGAGGG - Intergenic
926011011 2:9407882-9407904 CTGTGTGTTTGGGGGTGGGGGGG + Intronic
927377322 2:22433210-22433232 GTGTGGGTTGGTGGGTGAGAAGG + Intergenic
927489193 2:23509431-23509453 CTGTGGATCTGGGAGAGTGAGGG + Intronic
927659629 2:24981968-24981990 CTGTGGTTGTGGGTGTGAGTGGG - Intergenic
928902206 2:36331756-36331778 GTGTAGTGCTGGGGGTGAGAGGG - Intergenic
929052450 2:37849646-37849668 GTGTGGGGATGGGGGTGAGGTGG - Intergenic
929265267 2:39912047-39912069 CTGTGGGCTTGGGAGTAAGATGG + Intergenic
929558256 2:42938785-42938807 TTGTGGGGCTGGGGATGACATGG - Intergenic
929774219 2:44918145-44918167 CAGTGGGTCTGGAGGTGAGATGG + Intergenic
929957360 2:46468614-46468636 CTGAGGGGTTGGGGGTCAGAAGG - Intronic
932104002 2:68926495-68926517 CTGAGGGGCTGGGGTTCAGAAGG + Intergenic
933189146 2:79313818-79313840 GTGTGTGTTTGGGGGTAAGAGGG + Intronic
933685306 2:85136597-85136619 ATGTAGGTATGGGGGTGGGATGG - Intronic
934048654 2:88191709-88191731 GAGTGGGGCTGGGGGTGAGGTGG - Intergenic
934067067 2:88350467-88350489 CAGTGGGTCTGGGGAGGAGGAGG + Intergenic
934187922 2:89763129-89763151 CTGCAGGTCTTGGGGAGAGATGG - Intergenic
934308684 2:91844819-91844841 CTGCGGGTCTTGGGGAGAGATGG + Intergenic
934858708 2:97745702-97745724 CTGTGGGTGGGGATGTGAGATGG + Intergenic
934951125 2:98576422-98576444 CTGTGGGGCTGGTGGTCAGGAGG + Intronic
935989481 2:108706115-108706137 CTGTGGGCCTGGGGTTGTGGTGG + Intergenic
936006595 2:108894407-108894429 TGGTGGGTCGGGGGGTGAGTGGG - Intergenic
936290631 2:111221073-111221095 ATTTGGGTGTGGGGGTGAGAGGG - Intergenic
936627480 2:114163848-114163870 CTGTGACTATGGGGGAGAGAAGG + Intergenic
936732902 2:115405492-115405514 CTGTGGGTCTGGAGTCCAGAGGG + Intronic
936996288 2:118417453-118417475 CTGTGGGACAAGGGGTGGGAGGG - Intergenic
937009605 2:118550807-118550829 CTGAGGGTGAGAGGGTGAGAGGG - Intergenic
937027979 2:118714918-118714940 GTGGGGGTGAGGGGGTGAGAGGG + Intergenic
937362555 2:121239169-121239191 CACTGAGTGTGGGGGTGAGAGGG - Intronic
940030976 2:149260869-149260891 GTGTGGGGCGGGGGGTGAGGGGG + Intergenic
940098726 2:150008828-150008850 CATTAGGCCTGGGGGTGAGATGG + Intergenic
940105088 2:150090399-150090421 CTGTGGTTGTGGGAGTGAAAAGG - Intergenic
941396851 2:164983878-164983900 CTTTGGGTATGGGTGTGAGAGGG + Intergenic
941725799 2:168858781-168858803 CTGGAGGTGTGGGGGAGAGAGGG + Intronic
942364959 2:175215757-175215779 TTGTGGGTTTGGGGGAGAGGCGG - Intergenic
942772959 2:179545014-179545036 CTGTAGGTTTGGGAGGGAGATGG - Intronic
945854584 2:215053541-215053563 CTGTGGGTCTTTGGCTGAGTAGG - Intronic
946902286 2:224384145-224384167 CTGTGGGACTGGGTGACAGAGGG - Intronic
946969418 2:225075136-225075158 CTGTTGCACTGGGGGTGAGGAGG - Intergenic
947746242 2:232508679-232508701 CTGTGGGTGTGTGTGTGAGCTGG - Intergenic
948804578 2:240447967-240447989 CGCTGGCTCTGGGTGTGAGATGG + Intronic
948813734 2:240499342-240499364 ATGTGGGGGTGGGGGTGAGTAGG + Intronic
948900313 2:240953476-240953498 CTGTGGGTCCAGGGGAGGGAGGG - Intronic
1168803839 20:661665-661687 ATGGGGGTTTGGGGGTGAGTTGG + Exonic
1169021249 20:2332806-2332828 TTGTGGGAGTGGGGGTGAGGTGG - Intronic
1169074278 20:2751828-2751850 CTGTGGGCAAGGGGGTGAGGAGG + Intronic
1169169604 20:3454208-3454230 CAGTGGTTATGGGGGTGAGGAGG - Intergenic
1169258173 20:4114803-4114825 CTGTGGTGTTGGGGGTGGGAGGG - Intergenic
1169649150 20:7847594-7847616 CTGGATGTCTGGGGGTGAGGAGG - Intergenic
1170512836 20:17096685-17096707 CTGTGGGTCAGGGGTTTGGATGG - Intergenic
1170527006 20:17248958-17248980 CTGTGGCTCAGGGGGTGCCAGGG - Intronic
1172007035 20:31824669-31824691 CTGGGGGTCTGGGAGTGAAGTGG + Intronic
1172107988 20:32528016-32528038 CAGTGGGTCTTGGGGTGGGGAGG + Intronic
1172176085 20:32972706-32972728 CTGGGGGTCTGGGTGTGGGATGG + Intergenic
1172767555 20:37358842-37358864 CAGTGGGGCTGGGGTGGAGACGG - Intronic
1172773521 20:37394802-37394824 CTGTGGGCCTGGGGCTCAGCGGG + Intronic
1172977515 20:38918142-38918164 CTGGGGTTCTGCGAGTGAGAAGG - Exonic
1173252852 20:41373819-41373841 CTGGGGCTCTGGGTGTGGGAAGG + Intergenic
1173409154 20:42794302-42794324 ATGGAGGTGTGGGGGTGAGAGGG - Intronic
1173737765 20:45373842-45373864 CTGTTTGTCTGGGGCTGGGAAGG - Exonic
1173801809 20:45898832-45898854 CTGTGGCACTGGGGGTTAGAGGG + Exonic
1173976142 20:47188158-47188180 GAGGGGGTCTGAGGGTGAGATGG - Exonic
1174090593 20:48044055-48044077 CTGTGACTTTGGGGCTGAGAAGG + Intergenic
1174104781 20:48154472-48154494 CTGTGGGTATGAGGCTCAGAGGG + Intergenic
1174115749 20:48225312-48225334 GTGTGCGCCTGTGGGTGAGATGG - Intergenic
1174201853 20:48811934-48811956 AAGTGGGTCTGCGGTTGAGATGG - Intronic
1174390478 20:50215848-50215870 CTGGGGGGCTGGGGGTGGGAGGG + Intergenic
1174455015 20:50642706-50642728 ATGTGGGGCAGAGGGTGAGAGGG - Intronic
1174560436 20:51427191-51427213 TGGTGGGTTTGGTGGTGAGATGG + Intronic
1174882175 20:54292014-54292036 CTGTGGGTTAGGTGGGGAGAGGG - Intergenic
1175134483 20:56812643-56812665 GTGTGTGTTTGGGAGTGAGAGGG + Intergenic
1175246336 20:57584455-57584477 GTGTGGGTCTGAGGGTCAGAGGG + Intergenic
1175485672 20:59344254-59344276 TTGTGAGTCTGGGGGTAAGCAGG - Intergenic
1175614596 20:60385329-60385351 CTTAGGGTTTGGGAGTGAGAAGG + Intergenic
1175949755 20:62577045-62577067 CTGAGGGTCTGGGAGTCAGCTGG - Intergenic
1176039223 20:63055729-63055751 CTCTGGGCCTGGGGGTGGGCTGG + Intergenic
1176121090 20:63454912-63454934 CTGTGGGCCTGGGTCTGAGGTGG - Intronic
1176142116 20:63549297-63549319 CGGTGGGTGTGGGGAGGAGACGG - Intronic
1176144828 20:63560952-63560974 CTCTGGGTCTAGGGGTGTCAGGG - Intronic
1176210019 20:63915058-63915080 CTGTGGGTCCCAGGGAGAGACGG + Intronic
1177595336 21:23232854-23232876 CTGGGGATGTGGGGTTGAGATGG + Intergenic
1178286252 21:31327933-31327955 CTGCGGGACTGCTGGTGAGATGG - Intronic
1178763062 21:35422561-35422583 CTCTGGGTCTTGGGGTGATGAGG - Intronic
1179123941 21:38575064-38575086 CTGAGGCTCTGGAGGTGAGAGGG - Intronic
1179414660 21:41188555-41188577 CCCTGGGTCTGGGGGGGTGATGG - Intronic
1180070356 21:45432757-45432779 CTGTGGGTCAGGGTGGGACATGG + Intronic
1180535770 22:16391906-16391928 CTGCGGGTCTTAGGGAGAGATGG + Intergenic
1180709944 22:17832730-17832752 CTGTGGGTGTGGTGGGGGGAGGG + Intronic
1180871424 22:19149273-19149295 CGGTGGGTCTGGACGCGAGATGG + Intronic
1181043229 22:20202769-20202791 CTGTGGGACTGCAGGGGAGACGG + Intergenic
1181419891 22:22790421-22790443 CTCTGGGTCTGAGGGAGAGTTGG + Intronic
1182141739 22:27965476-27965498 GGGTGGGTCTGGGGGACAGAAGG - Intergenic
1182434914 22:30324446-30324468 CTGTAGGGCTGGGGCTGAGGTGG - Intronic
1182515298 22:30855320-30855342 CTTTGGCTCTGGGATTGAGAAGG - Intronic
1182527592 22:30931054-30931076 CAGTGGGCTTGGGGGTGAAAGGG - Intronic
1183321369 22:37167068-37167090 CTCTGAGTCTGGGGGTTAGGTGG - Intronic
1184414586 22:44344880-44344902 CTGTTGGCCTGGGGGAGGGAGGG - Intergenic
1184638772 22:45857504-45857526 TTGTGTGTCAGGGGGTGCGAAGG - Intergenic
1184977139 22:48070290-48070312 GTCTGGGTCTGGGGGAGAGTAGG - Intergenic
949151591 3:774620-774642 CTGTGTGTTTGGAGGTGATAGGG - Intergenic
949801820 3:7912495-7912517 CTCTGGTTTTGGGGGTGATAGGG - Intergenic
950090308 3:10290202-10290224 AGGTGGGCCTGGGGGAGAGAGGG + Exonic
950101510 3:10359735-10359757 CTGTGGCTCTGGGTGCTAGACGG + Intronic
950215049 3:11153484-11153506 GTGTGGGGGTGGGGGTCAGAGGG - Intronic
950707112 3:14789723-14789745 CTGTCTGTCTGGGGGCAAGACGG + Intergenic
951299295 3:20974731-20974753 CTGTGTGTTTGGGGGTGTGGTGG - Intergenic
951532746 3:23713037-23713059 CTGTGGGGGTTGGGGAGAGAAGG - Intergenic
952687258 3:36164035-36164057 GTGTGTATCTGAGGGTGAGATGG - Intergenic
952963293 3:38606141-38606163 CTGAGGGTCTGGGGGAGCAAGGG + Exonic
953186594 3:40643400-40643422 CTCTGAGGCTGGGGGAGAGATGG + Intergenic
953285354 3:41601501-41601523 TTGTGGGTTGGAGGGTGAGAGGG + Intronic
953422642 3:42766251-42766273 GGGTGGGTCTGGGGTTCAGAAGG + Intronic
953449900 3:42997269-42997291 TGCTGGGTCTGAGGGTGAGAAGG + Intronic
954150212 3:48653586-48653608 CTGAGGGTATAGGGGTGAGCAGG + Intronic
954154802 3:48679450-48679472 CTGGTGGTCTGGGGGGGACAAGG + Exonic
954239861 3:49285078-49285100 TTTTGGGGCTGGGGGTCAGAAGG - Intronic
954454131 3:50587922-50587944 CTGAGGGTTTGGATGTGAGATGG + Intergenic
955731842 3:61995594-61995616 GTGTGGGTATGGGGGTGTGTAGG + Intronic
957398251 3:79673320-79673342 GTGTGGGTGTGGGTGTGTGAGGG + Intronic
958060697 3:88476247-88476269 CTGTGGGGGCGGGGGTGGGATGG - Intergenic
958833027 3:99112546-99112568 CTGTGTGTCAGGGGGTGAGAGGG + Intergenic
959260364 3:104071697-104071719 CTGTGGGTGTGTGGGTGGGTGGG + Intergenic
960284453 3:115811237-115811259 ATGTGGGTGTGGGTCTGAGAGGG + Intronic
961260143 3:125595514-125595536 CTGTGGGGCTGTGGGTGGGGCGG - Intergenic
961474442 3:127137948-127137970 CTGTGGGTGTGTGAGTGGGAGGG - Intergenic
961869534 3:129977473-129977495 CTGTGGTGGGGGGGGTGAGAGGG - Exonic
962254532 3:133861368-133861390 ATGTGTGTTTGGGGGTGAGGAGG + Intronic
963274173 3:143313969-143313991 CTGTGGGACTGCGGATGTGAGGG + Intronic
963431854 3:145216804-145216826 CTGTGTGTGTGGGGGTGGGAGGG + Intergenic
964037888 3:152220830-152220852 GTGGGGGTTTGGGGGAGAGAGGG - Intergenic
965540937 3:169870741-169870763 ATGTGGGTCAGGGGGTGTGGAGG + Intergenic
965811167 3:172592810-172592832 TTGGGGGTTGGGGGGTGAGAGGG - Intergenic
966234605 3:177686758-177686780 GGGAGTGTCTGGGGGTGAGAAGG - Intergenic
968194522 3:196695419-196695441 CTGTGGGTGTGGGTGTGTGTGGG - Intronic
968284977 3:197503200-197503222 CTGTGGGGCTGAGGGCGTGAGGG - Intergenic
969344684 4:6563479-6563501 CTGCGGGGCTGGGGGTGAGGCGG + Intronic
969533525 4:7742036-7742058 CTTTGGGTCTGGGGGACAGGTGG - Exonic
969845450 4:9916872-9916894 CTGAGTGTCTGGGGGAGAAAAGG - Intronic
970214968 4:13749381-13749403 GTGTGTGTCTGGGGGGGAGTTGG - Intergenic
971753636 4:30681191-30681213 CTGTGGGGCTGGGGGTTAGGGGG - Intergenic
976861170 4:89668840-89668862 AGGTGGGACTGGGGGTGGGATGG - Intergenic
977823679 4:101504914-101504936 CTTTGGGTTTAGGGGAGAGATGG + Intronic
979061361 4:116066384-116066406 TGGGGGGTCGGGGGGTGAGAAGG + Intergenic
980792909 4:137642650-137642672 CTGTGGAACTTGGGGTGTGAGGG + Intergenic
980861221 4:138501645-138501667 GTGTGTGTCTGGGGGTCAGGTGG - Intergenic
981011373 4:139928668-139928690 CTGTGTGTCTGGGTGGGAAATGG + Intronic
981247529 4:142557444-142557466 CTGTGTGTCTGTGTGTGAGTGGG - Intronic
981375775 4:144013766-144013788 CTGTGGGGTTGGGGGGGAGGGGG + Intronic
982671521 4:158325485-158325507 CCCTGGGTCTGGGGGTGCAATGG - Intronic
982955708 4:161763528-161763550 CTATGGGTGTAGGGGAGAGAAGG + Intronic
983074784 4:163312739-163312761 CTGTGTGTATGGGGGTGGCAAGG - Intergenic
984784348 4:183554067-183554089 ATGTGGGTGTGGGTGTGAGTGGG + Intergenic
985515905 5:344380-344402 CTGTGTGTCTGCGGGTGGGGAGG + Intronic
985846562 5:2354028-2354050 CTGCGGGTCTGGGGATGTGCAGG - Intergenic
986221861 5:5775543-5775565 GTGTGGGCCTGGAGGTAAGAGGG + Intergenic
986564241 5:9095246-9095268 GTGGGGGTCTGGGGCTGGGAAGG + Intronic
986572736 5:9181873-9181895 CTCTGCGGCTGGGAGTGAGATGG - Intronic
986686337 5:10278387-10278409 ATGTGGGTGTGGGGGTCAGTGGG - Intronic
987696785 5:21342740-21342762 CTATGGGGGTGGGGGAGAGAGGG - Intergenic
988687537 5:33539581-33539603 CTGTGGGTCTTGAGTTGAGAAGG - Intronic
988755419 5:34243807-34243829 CTATGGGGGTGGGGGAGAGAGGG + Intergenic
989100890 5:37822073-37822095 CTGTGGGCCTGAGAGGGAGATGG + Intronic
991169493 5:63604364-63604386 CTGCTGGGCTGGGGGTGAGCTGG + Intergenic
991754054 5:69845697-69845719 CTATGGGGGTGGGGGAGAGAGGG - Intergenic
991803679 5:70402456-70402478 CTATGGGGGTGGGGGAGAGAGGG - Intergenic
991823026 5:70584813-70584835 CTATGGGGGTGGGGGAGAGAGGG + Intergenic
991887593 5:71288789-71288811 CTATGGGGGTGGGGGAGAGAGGG + Intergenic
992225032 5:74611934-74611956 CTGTGTGTCTGTGTGTGAGCGGG + Intergenic
992397406 5:76380574-76380596 CTGTGGCTCTGGGAGTCAGAGGG + Intergenic
992891272 5:81206556-81206578 CAGTGAGTCTGAGGGTGAGCTGG - Intronic
993613667 5:90084543-90084565 CAGTGAGCCTGGGGGTGACATGG + Intergenic
993885566 5:93411696-93411718 ATCTGTGCCTGGGGGTGAGATGG - Intergenic
994748988 5:103715337-103715359 CTGGGGGTCGGGGGCTGAGGGGG + Intergenic
995799510 5:115978809-115978831 CCATGGGGCTGGGGGTGACAGGG + Intronic
996532865 5:124544490-124544512 CTGAGGGGCTGAGGGTGAGTAGG - Intergenic
997230068 5:132235819-132235841 CTGTGGGTGAGTGGGGGAGAAGG + Intronic
997723987 5:136105016-136105038 CGGAGGGAATGGGGGTGAGAGGG + Intergenic
998137047 5:139679318-139679340 TTGTGGTTCGGGGGTTGAGAAGG + Intronic
999269768 5:150289960-150289982 GTGTGGGCCTGGGGGTGGGATGG + Intronic
999379618 5:151110938-151110960 CTCTGGGTTTTGGGGTGCGAAGG - Intronic
999394332 5:151217400-151217422 ACTTGGGGCTGGGGGTGAGAGGG + Intronic
999484918 5:151985637-151985659 GTGTGGGGCAGGGGGTGAGGGGG - Intergenic
999684126 5:154087246-154087268 CTCTGGGTTTGGGAGAGAGATGG - Intronic
999779980 5:154841394-154841416 CTGTGGACTTGGGGGTTAGAGGG + Intronic
1000303794 5:159977729-159977751 GTGTGGGTGTTGGGGTGAGGAGG + Intergenic
1001872707 5:175170685-175170707 CCCTGGTTCTGTGGGTGAGAGGG - Intergenic
1002345987 5:178547734-178547756 GTGTGGGTGTGGGGGTGTGTGGG - Intronic
1002346092 5:178548062-178548084 GTGTGTGTGTGGGGGTGAGGGGG - Intronic
1002435604 5:179229069-179229091 CTGAGGGTCTGACGGAGAGAGGG - Intronic
1002829229 6:804241-804263 CTTAGGGTCTGCTGGTGAGATGG + Intergenic
1003232208 6:4264589-4264611 CTTTGGTTCTGCTGGTGAGATGG + Intergenic
1003316219 6:5014418-5014440 CTCTGCTTCTGGGGGTGAGCTGG + Intergenic
1004046596 6:12031160-12031182 CTGTGGGTCTGTGTGTGGGCTGG + Intronic
1004069919 6:12288568-12288590 GTGTGGGTGTGGGTGTGGGAGGG + Intergenic
1004228644 6:13811787-13811809 ATGTGGGGGTGGGGGTGAGGAGG - Intronic
1004497095 6:16174920-16174942 CTGGGGGTTGGGGGGTGAGTGGG - Intergenic
1005554052 6:26955578-26955600 CTATGGGGGTGGGGGAGAGAGGG + Intergenic
1005825516 6:29629263-29629285 AGGTGGGTCTGGGGGTAAGGGGG + Intronic
1005990660 6:30899729-30899751 CTGAGAATCTGGGGGTGAGGAGG + Intronic
1006143166 6:31943202-31943224 CTGTGGGTGTGAGGATCAGATGG - Intronic
1007397739 6:41587177-41587199 CTGTGGGGTTGGGGCTGGGAGGG - Intronic
1007769338 6:44180511-44180533 CTGTAGGGCTGGGGGTTGGAAGG + Intronic
1012981544 6:105835624-105835646 CGGTGGGTTTGGGAGTGAGTGGG - Intergenic
1013429543 6:110043445-110043467 CTAGGGGTCAGGGGGTGAAAAGG - Intergenic
1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG + Intergenic
1013874167 6:114803796-114803818 GTGTGTGTCTGCAGGTGAGATGG + Intergenic
1014903778 6:127002020-127002042 CTGTGTGTTGGGGGGTGAGTGGG - Intergenic
1015823667 6:137289788-137289810 CTGTGAGACTGGGAGAGAGAGGG + Intergenic
1016022373 6:139249611-139249633 CTTGGGGTGTGGGTGTGAGAGGG + Intronic
1017721769 6:157248083-157248105 CAGTGTGTCTGGGGGTGGGGTGG + Intergenic
1018276326 6:162135670-162135692 CTGTGGATCTGCAGATGAGAGGG + Intronic
1019158938 6:170056885-170056907 CTGTAGGTGTGGGGGAAAGATGG - Intergenic
1019164340 6:170088241-170088263 CTGTGGGGCTGGGAGTGAGCGGG + Intergenic
1019435059 7:1018362-1018384 CTTTGAGTCTGGGTCTGAGATGG - Intronic
1019519103 7:1452660-1452682 CTGTGGGTCTGGGGGTGAGATGG - Intronic
1019795589 7:3045809-3045831 CTGTGGGTCTTGGTGTTAGAAGG - Intergenic
1021634818 7:22681949-22681971 CAGTGGGGGTGGGGGTAAGAAGG - Intergenic
1022276118 7:28856568-28856590 CTGGAGGAGTGGGGGTGAGAAGG - Intergenic
1023265847 7:38404414-38404436 CTGTGGGGCTGGGAGTGTGGAGG - Intronic
1023965313 7:44960964-44960986 CTGAGGGGCTGGGGCTGAGGGGG + Intergenic
1024255921 7:47539928-47539950 CTGAGGGTCTGGGGATGCGAAGG + Intronic
1024473641 7:49788671-49788693 CTGTGAGTGTGGGTGTGTGAGGG + Intronic
1026178972 7:68022137-68022159 CTGTGGGTCTGTGGGTGTCCAGG - Intergenic
1026570072 7:71521650-71521672 CTCAGGGCCTGGGCGTGAGAAGG - Intronic
1027430850 7:78111059-78111081 CTTTAGGTCTGGGGGAGAGATGG + Intronic
1028002987 7:85524699-85524721 CTGTGGGGCTGGGGGAGTGGAGG + Intergenic
1028234792 7:88347604-88347626 CTGAGGGTCTGGTGGTAAGTTGG + Intergenic
1028487259 7:91373592-91373614 CTGTGGGCCTGGGAGTGGAAAGG - Intergenic
1029147356 7:98455993-98456015 GTGTGTGTCTGGGAGTGAGTAGG + Intergenic
1029511344 7:100997331-100997353 CTGAGGTTGTGGGGGTGCGAGGG - Exonic
1030110365 7:106021614-106021636 GTGTGTGTTTGGGGGTGTGATGG + Intronic
1030185436 7:106757248-106757270 CTTTGGGACTGGGCTTGAGAAGG + Intergenic
1030297517 7:107943829-107943851 CTGTGTGTCTGTGTGAGAGATGG + Intronic
1031454737 7:121965172-121965194 CTGTGGGTCAGGAGCTGAGGAGG + Intronic
1032806740 7:135362810-135362832 CTGTGGGTGGTGGGCTGAGAGGG + Exonic
1033222300 7:139536216-139536238 CAGTGGGACTGGCGGTGGGATGG + Intronic
1033259577 7:139831196-139831218 CAGAGGTTCTGGGGGTGAGCTGG + Intronic
1034077760 7:148249230-148249252 CAGTGGGTTTGGTGGTGAGAAGG - Intronic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034427810 7:151023845-151023867 GTGTGGGTGTGGGTGGGAGAGGG - Intronic
1034437400 7:151069738-151069760 CTGGGGGTCTGGGGGAGGGGAGG + Intronic
1034480177 7:151313957-151313979 GTGTGAGTGTGGGTGTGAGATGG + Intergenic
1034569534 7:151944279-151944301 CTGTGGGGCTGGGGAGGAGGGGG - Intergenic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1035248569 7:157581379-157581401 CTGTGGGCCTGGGGTGGGGAGGG + Intronic
1036642809 8:10594566-10594588 CTGTGGGGCTGGGGAGGGGAGGG + Intergenic
1037366504 8:18128251-18128273 CTGTGGGGGTGGGGGTAAGGAGG - Intergenic
1037513723 8:19609648-19609670 ATGGGGGTTGGGGGGTGAGAGGG + Intronic
1037693991 8:21207899-21207921 CTGTGGGGGTGGGGGGTAGAGGG - Intergenic
1037961158 8:23099323-23099345 CAGTGGATCTGGGGATGAGGAGG - Intronic
1037970521 8:23168534-23168556 CAGTGGATCTGGGGATGAGGGGG + Intergenic
1038436356 8:27539529-27539551 ATGTGGGTGTGGGGGAGGGAAGG - Intronic
1038495511 8:27999391-27999413 AGGTGGGCATGGGGGTGAGAGGG - Intergenic
1038686888 8:29727113-29727135 CTGCTGCTCTGGGGGTGGGAGGG + Intergenic
1039439205 8:37583284-37583306 GTGTGGGTCGGGGGGAGAGATGG - Intergenic
1040596995 8:48847985-48848007 CTGTGGGTCTGGGGAGGGGTGGG + Intergenic
1041730461 8:61057044-61057066 CAGAGGGTCTGAGGGTGAGGGGG + Intergenic
1042656661 8:71106207-71106229 CTGTATGTAAGGGGGTGAGAGGG - Intergenic
1042692738 8:71520663-71520685 CTCTGGCCCTGGGGGTGTGAAGG - Intronic
1043214981 8:77574355-77574377 CTGTGGGCCTGGGGTGGAGGTGG + Intergenic
1044305820 8:90639373-90639395 CTGTGTGTATGTGGGTGGGAGGG - Intronic
1045673428 8:104582928-104582950 CTGTAGGTTTTGGGGTGGGAAGG - Intronic
1045959138 8:107946504-107946526 CTGTGGGACTGGGGCACAGAAGG + Intronic
1046131866 8:109975565-109975587 CTGTTGGACTCGGGGTGAGGAGG + Intronic
1046768746 8:118098041-118098063 CCCTGGGGCTGGGGATGAGAAGG + Intronic
1047436961 8:124842825-124842847 CTTTGGGGGTGGGGTTGAGAAGG + Intergenic
1048251020 8:132866884-132866906 CTGAGGACCTGGGGGTGGGAAGG + Intergenic
1049274299 8:141711992-141712014 CTGTGGGTCTCGAGGTGATGGGG + Intergenic
1049342813 8:142122569-142122591 CTGTGGGTCTGGGGCAGGCAAGG - Intergenic
1049362010 8:142216333-142216355 CTGGGGGTGTGGGGCTGGGAAGG + Intronic
1049401082 8:142427664-142427686 CCGAGGGCCTGGGGGTGGGAGGG - Intergenic
1049432467 8:142571676-142571698 CTGTGGGCCTGTGGGGGAGCGGG - Intergenic
1049472816 8:142783880-142783902 CTGAGGGGCTGGGGGCGAGTGGG - Intergenic
1050072314 9:1828248-1828270 CTGTGGTTCTGAGGATGAAATGG - Intergenic
1051515158 9:17922539-17922561 CTGTGGTTATGTGGGTGAGGGGG - Intergenic
1051780580 9:20684400-20684422 CTGCGGGGCTGGGGCTGAGCTGG + Intronic
1052853153 9:33390374-33390396 TAATGGGTCTGGTGGTGAGAGGG + Intronic
1052985718 9:34485921-34485943 CAGTGGGGCTGGGGGTGGGGAGG - Intronic
1055510563 9:76992076-76992098 CACTGGGTCTGGCGGTGTGAAGG - Intergenic
1055758458 9:79580973-79580995 CTATGTGTGTGGGGGTGGGAAGG + Intronic
1056631352 9:88295649-88295671 CTGTGGATCTGGGGAAGAGGGGG - Intergenic
1056722089 9:89081453-89081475 CTCAGGGTGTGGGGGTGGGAGGG - Intronic
1056790880 9:89624573-89624595 CTGTGGATTTGGGGTTCAGAGGG + Intergenic
1056951429 9:91043466-91043488 CTGTGGGACTCGGTGTGGGAGGG - Intergenic
1057024077 9:91722683-91722705 CTGTGGGTCTGTGTGTAACAGGG + Exonic
1057031173 9:91776265-91776287 CAGTGGGTCTGGGGATGGGGAGG - Intronic
1057426031 9:94950509-94950531 CTGTGCATCTGGGGCTCAGATGG + Intronic
1058076143 9:100653730-100653752 CTGTGAGTCGGAGGGTGGGAGGG + Intergenic
1058847215 9:108972846-108972868 GTGTGGGTGGGGGGGTGGGAGGG + Intronic
1058923373 9:109639481-109639503 CTGAGGGACTGGGGTTGAAAGGG - Intergenic
1059397940 9:114050375-114050397 CTGTGGTTGTGGGGGTGTGGGGG + Exonic
1059953870 9:119495903-119495925 CAGTGAGGCTGGGGGAGAGAGGG + Intronic
1060004988 9:119991975-119991997 CCGGGGGTCTGGGGCTGAGAGGG + Intergenic
1060395933 9:123316561-123316583 CTGTGGGGATGGGGGTTGGAAGG + Intergenic
1061303643 9:129720573-129720595 CTGTGGGTGGGAGGGTGAGCAGG - Intronic
1061397174 9:130349522-130349544 AGGAGGGGCTGGGGGTGAGAAGG - Intronic
1061671033 9:132188269-132188291 CTGAGGGGCTGAGGATGAGAAGG + Intronic
1062010295 9:134263497-134263519 CTGTGAGCCGGGGGGTGGGAGGG - Intergenic
1062086922 9:134653808-134653830 CTGTAGGGCTGGGGGTGTGCAGG + Intronic
1062149827 9:135012227-135012249 CTTTGGGTCTGGGAGTCAAAGGG - Intergenic
1062296859 9:135835232-135835254 CTGTGTGTGTGGGGGCGGGAGGG - Intronic
1062365691 9:136207969-136207991 CTGTGGACCTGGGGGTTGGAAGG - Exonic
1062476950 9:136732967-136732989 CGGTGGGTGTGGGAGTGGGAAGG + Intergenic
1062557798 9:137123496-137123518 CTGTGTTTTTGGGGGTCAGATGG + Intergenic
1062564435 9:137157707-137157729 TTGGGGATCTGGGGGTGAGCTGG - Intronic
1062673029 9:137722934-137722956 CTGTGGTTCTGGGCCTGAGCCGG + Intronic
1062673055 9:137723045-137723067 CTGTGGTTCTGGGCCTGAGCCGG + Intronic
1185856707 X:3542826-3542848 ATGAGGGTCTTGGGGAGAGAGGG + Intergenic
1186654917 X:11601992-11602014 CTGTGTGTATGGAGGTGAGAGGG + Intronic
1186800751 X:13090253-13090275 GTGTGGATCTGGGGGATAGAAGG - Intergenic
1186820399 X:13282356-13282378 TAGTTGGTCTGGGGGTGATAGGG - Intergenic
1187225901 X:17375350-17375372 CTGTGTGTGTGTGGGTGAGTGGG - Intergenic
1187228137 X:17394010-17394032 CTGTGGGGCTGAGGGTGCGGTGG - Intronic
1187414462 X:19081223-19081245 CTGTGGGTGTGGGGGTGAGGTGG - Intronic
1189499184 X:41539111-41539133 CTGTGTGTGTGGGAGTTAGAGGG + Intronic
1189555358 X:42139128-42139150 GTGTGTGTCTGTGGGTGAGGGGG + Intergenic
1189672334 X:43424357-43424379 CTGTGGGTCAGGGGTTCATATGG - Intergenic
1190340620 X:49292639-49292661 CTGGTGGTCTGGGGGAGACACGG + Intronic
1190441101 X:50475063-50475085 CTGGGGGGCTGGGGGTGGGTGGG + Intergenic
1190627071 X:52346466-52346488 CTGGTGGTCTGGGGGAGATACGG + Intergenic
1191593178 X:62911957-62911979 CTGTGGGTCTGGGGTGGTGGTGG - Intergenic
1191908544 X:66122400-66122422 CTCTGGGGGTGGGGGTGAGGGGG + Intergenic
1192162740 X:68800738-68800760 CTGAGGCTCAGGGGATGAGAAGG - Intergenic
1192737160 X:73860769-73860791 CTCTGGGTCTGGTGGTGTGGCGG + Intergenic
1193152625 X:78140402-78140424 CTGTGGGTGAGGGGCTGGGAAGG - Intergenic
1193443247 X:81568141-81568163 CTGGGGGTCTGGGGTTCAAATGG + Intergenic
1193926316 X:87489719-87489741 GTGTGTGTCTGGGGGTGGGGTGG + Intergenic
1194921516 X:99772109-99772131 GTGGGGGCCTGGGGGAGAGAGGG - Intergenic
1194937759 X:99971190-99971212 CTGTGGGGATGGGGGAGGGATGG + Intergenic
1195236286 X:102901843-102901865 GTGTGGGCTTTGGGGTGAGAAGG + Intergenic
1197495282 X:127172253-127172275 ATGTGGGGGTGGGGGTGTGATGG + Intergenic
1197981135 X:132218381-132218403 CTACGGGTTTGGGGGTGGGACGG - Intronic
1199272224 X:145898065-145898087 CTGTGGGGCTGGGAGTGTGGAGG + Intergenic
1199828797 X:151528253-151528275 CAGTGTGTCTGGGGCAGAGAGGG + Intergenic
1199844226 X:151679095-151679117 CTGTGGGTCTGGGGGCACAAGGG + Intergenic
1199855694 X:151757141-151757163 CTGTGGGTGTAGGGGTGTGTGGG - Intergenic
1199892016 X:152094432-152094454 CTGTGTGCCTGGGGGTGGGTGGG + Intergenic
1200045857 X:153400832-153400854 CTGTGGGGCTGGGGGTCGGGAGG - Intergenic
1200111926 X:153744784-153744806 CTGTGGGTCTCGAGGAGAGATGG + Intergenic
1200275932 X:154732641-154732663 GTGTGAGTCTAAGGGTGAGAGGG + Intronic
1200397326 X:155998941-155998963 CTGGGAGTCTGGAGGTGAGACGG - Intronic
1200787029 Y:7269956-7269978 CTGTGTGTGTGTGTGTGAGATGG + Intergenic
1200807468 Y:7447296-7447318 ATGAGGGTCTTGGGGAGAGAGGG - Intergenic