ID: 1019519341

View in Genome Browser
Species Human (GRCh38)
Location 7:1453663-1453685
Sequence CACAGCCTGCAGGTTTGCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 256}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019519341_1019519349 -7 Left 1019519341 7:1453663-1453685 CCGCTGCAAACCTGCAGGCTGTG 0: 1
1: 0
2: 3
3: 28
4: 256
Right 1019519349 7:1453679-1453701 GGCTGTGGGATGGGGGCTGCAGG 0: 1
1: 3
2: 19
3: 186
4: 1079
1019519341_1019519350 14 Left 1019519341 7:1453663-1453685 CCGCTGCAAACCTGCAGGCTGTG 0: 1
1: 0
2: 3
3: 28
4: 256
Right 1019519350 7:1453700-1453722 GGTTGCCCACCTCCGAGACATGG 0: 1
1: 0
2: 0
3: 3
4: 90
1019519341_1019519354 25 Left 1019519341 7:1453663-1453685 CCGCTGCAAACCTGCAGGCTGTG 0: 1
1: 0
2: 3
3: 28
4: 256
Right 1019519354 7:1453711-1453733 TCCGAGACATGGCATCCTCCAGG 0: 1
1: 0
2: 0
3: 7
4: 84
1019519341_1019519356 26 Left 1019519341 7:1453663-1453685 CCGCTGCAAACCTGCAGGCTGTG 0: 1
1: 0
2: 3
3: 28
4: 256
Right 1019519356 7:1453712-1453734 CCGAGACATGGCATCCTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019519341 Original CRISPR CACAGCCTGCAGGTTTGCAG CGG (reversed) Intronic
900562202 1:3312657-3312679 CAGAGCCTGCAGCTTGGCCGAGG - Intronic
901186100 1:7374432-7374454 CCCAGCCTGCTGCTTAGCAGAGG + Intronic
901212705 1:7535371-7535393 GAAAGCCTGCTGGTGTGCAGGGG + Intronic
901710794 1:11113469-11113491 CCCAGGCTGCAGGCTTGAAGGGG + Intronic
901787886 1:11636768-11636790 CCCAGTCTGTAAGTTTGCAGTGG + Intergenic
902445717 1:16462625-16462647 CACTGACTGCAGCCTTGCAGAGG + Intergenic
903326479 1:22571709-22571731 CACATCCAGGAGGTCTGCAGAGG + Intronic
903668159 1:25020695-25020717 CACAGCCTCCGCTTTTGCAGAGG - Intergenic
904304940 1:29582582-29582604 CACTGCCTGGATGGTTGCAGGGG + Intergenic
904594486 1:31634726-31634748 CACTGCCTGGTGGCTTGCAGAGG + Intronic
904807049 1:33139698-33139720 CACAGCCTTTCTGTTTGCAGGGG - Intergenic
905608055 1:39322020-39322042 CAGAACTTGCAGGGTTGCAGAGG + Intronic
905828913 1:41048582-41048604 CAGAGCCTGCAGGTATGAAGTGG + Intronic
906051940 1:42881301-42881323 CAAAGCCAGCAACTTTGCAGTGG + Intergenic
906477607 1:46180514-46180536 CCCTGCCTGCAGGTGAGCAGTGG + Exonic
909678389 1:78263622-78263644 CACAGCTTGCAGGGTTGCAGGGG - Intergenic
910507980 1:87971964-87971986 CACAGTCCCCAGGTTTGGAGAGG - Intergenic
911095323 1:94050076-94050098 CACATCCTGCACATTTTCAGAGG - Intronic
912735303 1:112145034-112145056 CACAGACTGCAGGCTGGCAGGGG + Intergenic
912860385 1:113208878-113208900 CACAGCATGAAGGTTTGGACAGG + Intergenic
914339241 1:146744266-146744288 CACAGCATGTAAGTGTGCAGAGG - Intergenic
914980501 1:152410645-152410667 CAGAGCCAGCAGGGTTCCAGAGG - Exonic
915449773 1:155996529-155996551 CACACGCTGATGGTTTGCAGTGG - Intronic
915558185 1:156671338-156671360 CGCAGTCTGCAGATGTGCAGAGG - Exonic
915964090 1:160291458-160291480 CACAGGCTGCAGGTTTGAGTGGG + Exonic
916664930 1:166957980-166958002 ATCAGCCTGCAGTTGTGCAGTGG - Exonic
919112884 1:193242085-193242107 CATTGTCTGCAGGTTTGCAGGGG + Intronic
920275825 1:204803485-204803507 TTCAGCGTGCAGGTTTGGAGAGG - Intergenic
920416475 1:205802115-205802137 GAAAGCCTCCAGGTTTGGAGAGG + Intronic
920846315 1:209595793-209595815 GACACCCTGCAGGCTGGCAGAGG - Intronic
921190514 1:212704099-212704121 CACATCCTGCAGGTATCCAAAGG - Intergenic
1062983736 10:1747307-1747329 CAGATCCTGCAGCTTTGCAGGGG - Intergenic
1066347819 10:34606404-34606426 CACAGCATGCAGATTTGAGGAGG - Intronic
1073469699 10:103714950-103714972 AACAGCCTGCAGGGTGGTAGGGG + Intronic
1075411899 10:122234261-122234283 CACAGCCTGCAGGTCTGAAGTGG + Intronic
1077142305 11:1029991-1030013 CACCGCCCGTGGGTTTGCAGGGG + Intronic
1077374213 11:2198069-2198091 CCCAGCCTGCAGGGTAGCAGGGG + Intergenic
1078360975 11:10667402-10667424 CTCAGCCTGCAGGTCAGCACTGG + Intronic
1079800311 11:24860333-24860355 CTAAGTCTGCTGGTTTGCAGAGG - Intronic
1080600911 11:33819962-33819984 CACAGACTGCGGGTGTGGAGAGG - Intergenic
1081749373 11:45498733-45498755 CTCAGCCTACTGGTTTCCAGTGG + Intergenic
1081815003 11:45934102-45934124 CAGAGTCTACAGGTTTGGAGAGG + Exonic
1083487714 11:62993865-62993887 CACGGTCTGCAAGTCTGCAGAGG + Exonic
1083706167 11:64517906-64517928 CCCAGGCTGCAGGAATGCAGTGG - Intergenic
1083764035 11:64833654-64833676 CACAGCCTGCAGGAGGGCGGGGG + Exonic
1083959732 11:66007842-66007864 CAGAGCCTCCAGTTTTGCAGTGG - Intergenic
1084653449 11:70502127-70502149 CACAGCCTGGTGCTTTGCAAAGG + Intronic
1085121491 11:73970177-73970199 CACAGCCTCAGGGTGTGCAGGGG + Exonic
1086450683 11:86913376-86913398 CATAGCCTTCAGGTTTGTATTGG + Intronic
1086527431 11:87744651-87744673 CTCAGCCTGCACGTCTCCAGAGG - Intergenic
1086847207 11:91765671-91765693 CACCTCCTGCTGGTTTGAAGGGG + Intergenic
1088747078 11:112812900-112812922 CACACCATCCAGGGTTGCAGGGG - Intergenic
1089096095 11:115921213-115921235 AACGCCCAGCAGGTTTGCAGAGG - Intergenic
1090878472 11:130812704-130812726 CCCTGGCTCCAGGTTTGCAGTGG - Intergenic
1091583527 12:1802836-1802858 CACAGGCTGCCGGTGTGCAGAGG - Intronic
1094547608 12:31419525-31419547 CACAGACAGCACGTTTGTAGAGG + Intronic
1096656188 12:53093847-53093869 CAGAGGCTGCAGGTTAGCTGAGG + Intergenic
1096810972 12:54169737-54169759 CACAGCATGCAGAATAGCAGTGG - Intronic
1097139285 12:56886420-56886442 TTAAGCCTGCAGGTGTGCAGAGG + Intergenic
1097580473 12:61449653-61449675 CACAGGCTGCTGGAGTGCAGTGG - Intergenic
1102282146 12:111626823-111626845 CACTGCCTGCAGGAGAGCAGGGG + Intergenic
1103710707 12:122910384-122910406 AACAACCTGCAGGTTTGAGGAGG - Intergenic
1104013465 12:124947874-124947896 CTCAGCCAGCAGGTCTGCAGGGG + Exonic
1104476596 12:129075558-129075580 CACAGCCTGCAGCCCTGCAGTGG - Intronic
1105621623 13:22072931-22072953 CTCAGCATGAAGGTTTCCAGTGG + Intergenic
1105881062 13:24607008-24607030 CACAGGCTGCAGCAGTGCAGAGG + Intergenic
1106996143 13:35483839-35483861 CACAGCCTGCATGCATGCATGGG - Intronic
1109273764 13:60281827-60281849 CACTGTCTGCAGGTTACCAGTGG - Intergenic
1109491054 13:63100701-63100723 TTAAGCCTGCAGGTGTGCAGAGG + Intergenic
1109780596 13:67106571-67106593 TGCAGCCAGCATGTTTGCAGTGG - Intronic
1112627651 13:101123878-101123900 CACTCACCGCAGGTTTGCAGGGG + Intronic
1115261802 14:31461997-31462019 AACAGGCTGCAGTTTGGCAGAGG - Intergenic
1115999850 14:39231380-39231402 CACAGCTTGTAGATTTGCAAAGG + Intronic
1119182200 14:72612841-72612863 CACAGCCACCAGGGTTGCAAAGG - Intergenic
1119690780 14:76670667-76670689 CCCAGGCTGGAGTTTTGCAGTGG + Intergenic
1119840549 14:77789605-77789627 CACCTCCTGCAGTTTTCCAGTGG - Intergenic
1119856714 14:77906586-77906608 CATAGCAAGAAGGTTTGCAGTGG + Intronic
1121438827 14:93936105-93936127 CACAGGCTGCTGGTGAGCAGAGG + Intronic
1121641963 14:95490831-95490853 CACAGCCTGCAGGTGTGAGAAGG - Intergenic
1122408344 14:101513426-101513448 CGCATCCTGCAGGGTTGCTGTGG - Intergenic
1123984825 15:25635955-25635977 CACATCCTGCAGGGTTCTAGGGG + Intergenic
1124868454 15:33517032-33517054 CCCAGGCTGCTGGTGTGCAGTGG + Intronic
1127785808 15:62353745-62353767 CACAGCATGGAGGTTTGGTGTGG - Intergenic
1127856982 15:62961203-62961225 CTCAGCCTGCAGGTCTGAAGTGG + Intergenic
1128232123 15:66042738-66042760 CGGAGCCTGCAGTTATGCAGCGG - Intronic
1128361584 15:66965380-66965402 CACAGCCTGCAGCTCCGCGGTGG + Intergenic
1129035872 15:72648110-72648132 CAGAGCCTGCAGGACAGCAGAGG - Intergenic
1129214013 15:74089106-74089128 CAGAGCCTGCAGGACAGCAGAGG + Intergenic
1129399999 15:75276257-75276279 CAGAGCCTGCAGGACAGCAGAGG - Intronic
1129472894 15:75765032-75765054 CAGAGCCTGCAGGACAGCAGAGG + Intergenic
1129731148 15:77933451-77933473 CAGAGCCTGCAGGACAGCAGAGG + Intergenic
1131771019 15:95737292-95737314 CACTGCCCTGAGGTTTGCAGGGG - Intergenic
1132196285 15:99916881-99916903 CAGAGCCTGCAGGCCTGCTGGGG - Intergenic
1132263776 15:100448621-100448643 CACAGGCTGCAGTTTGGCGGAGG - Intronic
1132643806 16:989735-989757 CACAGCCCCCTTGTTTGCAGTGG - Intergenic
1132868646 16:2105778-2105800 CCCTGCCTGGAGCTTTGCAGAGG - Intronic
1133121393 16:3611072-3611094 GCAAGCCTGCAGGTTTCCAGAGG + Intronic
1133324279 16:4934069-4934091 CACAGCCAGGAGGGTGGCAGCGG + Intronic
1133490126 16:6260092-6260114 AAGAGCCTGCAGATTTACAGTGG - Intronic
1133861477 16:9599451-9599473 CACAGCCTCCATGGTTGCTGTGG + Intergenic
1133866022 16:9644126-9644148 CACAGCCTGTGGGGGTGCAGAGG + Intergenic
1134088114 16:11372461-11372483 CACTGTCTCCTGGTTTGCAGTGG + Exonic
1135889179 16:26341926-26341948 CACAGACCACAGGTTGGCAGTGG + Intergenic
1135899250 16:26441559-26441581 CACAGCCAGCTGTGTTGCAGAGG - Intergenic
1137386450 16:48047304-48047326 CTTAGCCTGCTGGGTTGCAGGGG + Intergenic
1138138720 16:54547601-54547623 ATCAGCCTGCAGGTTTGTGGGGG + Intergenic
1139995036 16:70973086-70973108 CACAGCATGTAAGTGTGCAGAGG + Intronic
1140942423 16:79734437-79734459 CACATCCTGCTGGATAGCAGGGG + Intergenic
1141948044 16:87323686-87323708 CAGAAACTGCAGGTCTGCAGAGG - Intronic
1142210813 16:88807675-88807697 CAGAGGCTGCAGGTGTGGAGGGG - Intronic
1144046446 17:11458608-11458630 CTCAGCCTGAGAGTTTGCAGAGG - Intronic
1144673489 17:17146268-17146290 CACAGCCTTCATTTCTGCAGTGG + Intronic
1145068133 17:19777924-19777946 CACAGCCTTCTGGTATTCAGAGG + Intronic
1148094555 17:45043433-45043455 CCCAGCCTGCAGGGTTCAAGTGG - Intronic
1148954655 17:51343697-51343719 CCCTGGCTGCAGGTTGGCAGTGG - Intergenic
1149529667 17:57384888-57384910 CAGAAGCAGCAGGTTTGCAGAGG - Intronic
1151529168 17:74693377-74693399 CCCAGCCTGCAAGTTCTCAGGGG - Intronic
1151684300 17:75637733-75637755 CACAGCCAGCTGGCTTCCAGGGG + Exonic
1155079029 18:22389281-22389303 GTCAGCTTGCAGCTTTGCAGGGG + Intergenic
1155299083 18:24412320-24412342 GAGAGCCTGCAGGTCTGCACTGG + Intergenic
1157197282 18:45629724-45629746 CACAGACTGCAGTTTTACAAGGG + Intronic
1157283809 18:46363549-46363571 CACAGGAGGGAGGTTTGCAGGGG - Intronic
1157620427 18:49014147-49014169 CTTCGCCAGCAGGTTTGCAGAGG - Intergenic
1157808846 18:50678876-50678898 CACGGCCAGCAGGTTTTCTGGGG + Intronic
1158613806 18:58967713-58967735 CACGGCCTGCTGGGTTGCTGAGG + Intronic
1158753268 18:60291184-60291206 CACAGGCCGCACGTTAGCAGAGG - Intergenic
1159897125 18:74008008-74008030 CACATAGTGCAGGTGTGCAGGGG - Intergenic
1160729711 19:635613-635635 GCCAGCCTGCAGGGGTGCAGGGG - Intergenic
1160860605 19:1235913-1235935 CTCTGCCTGCGGGTGTGCAGGGG + Exonic
1161066716 19:2242210-2242232 CAGTGTCTGCAGGTGTGCAGGGG - Intronic
1163126418 19:15246646-15246668 CACAGCCTGCAGGCTGTGAGGGG - Intronic
1163288860 19:16365621-16365643 CCCAGCCTGTGGGTTTGCAGGGG + Intronic
1164999639 19:32750585-32750607 ACCTGCCTGCAGGTTTTCAGTGG - Intronic
1165304387 19:34994777-34994799 CACAGCATTCAGACTTGCAGGGG - Intronic
1165756056 19:38293608-38293630 CAGACTCTGCAGGCTTGCAGGGG - Intronic
1166219404 19:41354945-41354967 CATAGCCTGCAAGCTGGCAGCGG + Exonic
1166680656 19:44764478-44764500 CACAGGCTGGAGGAGTGCAGTGG + Intergenic
1166854715 19:45777811-45777833 CACAGCCTGCAGGATCTCGGGGG + Exonic
1167308414 19:48721861-48721883 CACAGCCTCCCGCTCTGCAGGGG + Exonic
1167320615 19:48795412-48795434 CACAGCCTGCAGCTTCACACCGG + Exonic
1167777323 19:51566964-51566986 CACTGCCAGAAGGTTTGCTGAGG - Intergenic
1168186197 19:54701202-54701224 CAGAGCATGCAGGTGTGCAGAGG - Intergenic
925151506 2:1618398-1618420 CACACCGTGCAGGATTACAGAGG - Intergenic
927297567 2:21471842-21471864 TACAGACTGCATGTTTGAAGTGG + Intergenic
927655142 2:24938913-24938935 CAAATCCTGCATGTATGCAGAGG - Intergenic
927988197 2:27428557-27428579 CACCGCCGGCAGGTTTCCATTGG - Exonic
928592938 2:32835615-32835637 TACAGCCTGCAGAACTGCAGAGG + Intergenic
929824892 2:45302429-45302451 GACAGCTTGCAGCTCTGCAGAGG + Intergenic
932392076 2:71402116-71402138 CAAAGCATGCATGCTTGCAGAGG - Intronic
933174243 2:79158422-79158444 CACAGACACCAGGTTTCCAGAGG + Exonic
934149991 2:89136997-89137019 CAGAGGCTGCAGTTTTGCAGTGG + Intergenic
934217304 2:90045031-90045053 CAGAGGCTGCAGTTTTGCAGTGG - Intergenic
934521910 2:95025216-95025238 CACAGGCTGGGGGTCTGCAGTGG - Intergenic
934729031 2:96644790-96644812 CTCAGTCTGCAGGTTTCAAGAGG + Intergenic
935515190 2:104027612-104027634 TACAGCATCCATGTTTGCAGAGG - Intergenic
936226757 2:110661598-110661620 AACAGACTCCATGTTTGCAGTGG - Exonic
936269373 2:111037109-111037131 CACAACCTGCAGGATGTCAGAGG - Intronic
937222256 2:120348538-120348560 CAGAGCCTGCTTGTTTGCAGTGG + Intronic
941270550 2:163422037-163422059 AACAGCATGAAAGTTTGCAGTGG + Intergenic
942067408 2:172284742-172284764 CTCAGCCTGCAAGAGTGCAGTGG + Intergenic
944520645 2:200563168-200563190 CACAGCCTCCAGTTTTGAATGGG - Intronic
946314147 2:218898289-218898311 CTCCGCCTGCGGGTCTGCAGGGG + Intronic
947817687 2:233048966-233048988 CAAAGCCTGCATTTTTCCAGTGG - Intergenic
948405743 2:237717566-237717588 CACAGCCTGCATGACTGCACGGG + Intronic
948575011 2:238944196-238944218 CAGGGCCTGCAGGGCTGCAGGGG + Intergenic
948887308 2:240890718-240890740 CACATCCTGTAGGCTTGCGGGGG - Intronic
1170762924 20:19266692-19266714 CACATTTGGCAGGTTTGCAGGGG + Intronic
1176193549 20:63825596-63825618 CATAGCCAGCCGCTTTGCAGAGG - Intronic
1176389309 21:6155421-6155443 CTGACCCTGCAGGTGTGCAGGGG - Intergenic
1177322862 21:19544876-19544898 CACAGCCTCCATGATTGCAGTGG + Intergenic
1179734161 21:43382817-43382839 CTGACCCTGCAGGTGTGCAGGGG + Intergenic
1180174110 21:46079210-46079232 CAGGTCCTGCAGGGTTGCAGAGG + Intergenic
1182411780 22:30193387-30193409 AACAGCCTGCAGTTTAGTAGAGG + Intergenic
1182450277 22:30416014-30416036 CACAGCGTGCAGATTTCCCGTGG + Exonic
1183828946 22:40407992-40408014 CACAGCCTGCAGGCAGGCTGAGG - Intronic
1184041721 22:41947910-41947932 CAGGGCCTGCTGGTGTGCAGCGG - Intergenic
1184939133 22:47748146-47748168 CACAGCCTCCAGGGTTGCCATGG + Intergenic
1185098988 22:48827583-48827605 CATGGCCTGCAGGCTCGCAGGGG - Intronic
1185379074 22:50498733-50498755 CACCCCCCGGAGGTTTGCAGAGG - Intergenic
1185396704 22:50595402-50595424 CATGGACTGCAGATTTGCAGTGG + Intronic
949834926 3:8257662-8257684 CACAGCCTGCAGCTGTTCTGTGG - Intergenic
950884529 3:16351507-16351529 CAAAGTCTGCGGGGTTGCAGAGG + Intronic
951622631 3:24622289-24622311 TACAGCCTGTAAGTGTGCAGTGG + Intergenic
951860296 3:27244624-27244646 CTGAGGCTGCAGGGTTGCAGAGG - Intronic
952083974 3:29795335-29795357 CTCAGCCTGGAGGTTTTCAGAGG - Intronic
952790855 3:37199613-37199635 CCCAAACTGCAGGTTAGCAGAGG + Intergenic
953804263 3:46054335-46054357 CACTGCCAGAAGGTTTGCTGAGG - Intergenic
953845963 3:46426659-46426681 CACTGCCAGAAGGTTTGCTGAGG + Intergenic
953846707 3:46433279-46433301 CACTGCCAGAAGGTTTGCTGAGG + Intergenic
953981666 3:47416329-47416351 CACAGCCAACAGGCTTGCTGAGG + Intronic
954754689 3:52832773-52832795 CAGAGCCTGCAGGTCCTCAGAGG + Intronic
955105042 3:55889647-55889669 CACAGCCTGCATCTGTGCAAGGG - Intronic
955458213 3:59149171-59149193 CACAGCCTGCAGCTGTGCTTTGG + Intergenic
956693091 3:71895620-71895642 CACAGTCTGCAGGTTTGGGGAGG - Intergenic
961627229 3:128272467-128272489 CCCAGGCTGGAGGTTTGCAGAGG + Intronic
962264229 3:133934283-133934305 CACACCCTGCAGAGTGGCAGGGG - Exonic
962271488 3:133980829-133980851 CACAGCCTCCAGGTCTGGAGAGG + Intronic
962349635 3:134647226-134647248 CACAGCCTCCAGGAGAGCAGGGG + Intronic
964545668 3:157830660-157830682 CACAGCCTCTTGGTTGGCAGGGG + Intergenic
964637332 3:158871809-158871831 CAGAGCTTGCAGGGTGGCAGTGG + Intergenic
966966078 3:184995398-184995420 CACAGATTCCAGGTTAGCAGAGG + Intronic
968017928 3:195356311-195356333 CACAGCCTGGAGGTTGGAACTGG + Intronic
968120168 3:196120423-196120445 CCCAGCCTGTAGGTTGGCATGGG + Intergenic
968229110 3:196994204-196994226 GACGGCCTGCAGCTCTGCAGGGG + Intronic
968516926 4:1019393-1019415 CACAGCCTGCAGGGGTGCCTGGG - Intronic
968794575 4:2694047-2694069 CTCAGCCTGTAGTTTTGCAGAGG + Intronic
969641642 4:8402277-8402299 CACTTCCTGCAGGTGGGCAGGGG - Intronic
971582922 4:28366241-28366263 CACATCCTGCAACTTTGCAATGG - Intronic
972163473 4:36254101-36254123 CACAGGCTGAAGGTGTGGAGTGG - Intergenic
972679946 4:41295681-41295703 CACAGCCGCCAAGTTTCCAGGGG - Intergenic
974287727 4:59891817-59891839 CGGAGCCTGCAGGCTTGCTGAGG - Intergenic
976503454 4:85818287-85818309 CACCCCCTGCAGGTGGGCAGGGG - Intronic
978635819 4:110804725-110804747 CACAGTCTGGAGGTCTGCTGGGG + Intergenic
979122391 4:116920137-116920159 TTAAGCCTGCAGGTATGCAGAGG + Intergenic
982064851 4:151645145-151645167 CACACCCTGCAGGTCTGATGTGG - Intronic
983694591 4:170512384-170512406 CACAGCCTGGAGATTTGGAAGGG + Intergenic
984452319 4:179918483-179918505 CAGAACATGCAGGTTTGCATAGG - Intergenic
984585101 4:181554254-181554276 CACCGCCCGCAGCTTTTCAGTGG - Intergenic
985484193 5:139762-139784 GTCAGCAAGCAGGTTTGCAGGGG - Intergenic
985631897 5:1018179-1018201 CACAGCCTACAGATGTGCACTGG + Intronic
986750183 5:10779955-10779977 GACAGCATGCAGGTGTGCAGTGG - Intergenic
992147290 5:73863893-73863915 CTCAGGCTGCAGGTCTGAAGAGG - Intronic
992291285 5:75282663-75282685 GACAGCCTAGAGATTTGCAGCGG - Intergenic
993134486 5:83940709-83940731 CACAGCTTGAAGGTTTGCAAAGG + Exonic
994172221 5:96670014-96670036 CAAAGACTTCAGGTTAGCAGTGG - Intronic
1001569519 5:172721044-172721066 CACAGCCAGCATGCTTGGAGGGG - Intergenic
1004495016 6:16155166-16155188 CACATCCTTCAGCTGTGCAGCGG + Intergenic
1004921222 6:20377808-20377830 CACAGCCTGCCAGATGGCAGTGG + Intergenic
1007159236 6:39775412-39775434 CACAGGTAGCAGGTGTGCAGAGG + Intergenic
1007553722 6:42748736-42748758 CACAGCCTGCAGCTGTGCAGGGG - Intronic
1010678088 6:78767811-78767833 TTAAGCCTGCAGGTGTGCAGAGG + Intergenic
1012999904 6:106011627-106011649 CACAGTAAGCAGCTTTGCAGGGG - Intergenic
1014146458 6:118003422-118003444 CACAGCCGGCAGGTTGCCATGGG - Intronic
1014982472 6:127960686-127960708 CATAGATTGCAGCTTTGCAGAGG - Intergenic
1018852237 6:167649101-167649123 CACAACCTGCAGGTCCACAGTGG + Intergenic
1019371558 7:664502-664524 CTCAGCCCCCAGGTCTGCAGGGG + Intronic
1019412838 7:914104-914126 CACAGCCTGCACCTTGGCTGTGG - Intronic
1019518098 7:1448402-1448424 CACAGCCTGGGGCTTTGCATGGG + Intronic
1019519341 7:1453663-1453685 CACAGCCTGCAGGTTTGCAGCGG - Intronic
1020213331 7:6171143-6171165 CACAGCCTCCAGCTCTGGAGGGG - Intronic
1022156016 7:27662698-27662720 GGCAGCCGGCAGCTTTGCAGCGG - Exonic
1022554305 7:31276442-31276464 GACAGCCTGCAAGGATGCAGGGG + Intergenic
1028382605 7:90215225-90215247 CACAACCTGCAGATTTGGAGAGG - Intronic
1028860093 7:95639468-95639490 CACAACGTGCAGGTTTCAAGTGG + Intergenic
1029109721 7:98206813-98206835 CACATCCTGCAGCTGTGAAGGGG + Exonic
1029692296 7:102190511-102190533 CACAGGCTCCAGGCTTGCAGGGG - Intronic
1030039597 7:105437706-105437728 CTCAGGCTGGAGGATTGCAGTGG + Intergenic
1031350337 7:120722999-120723021 GACAGCCTGCAGGGCAGCAGCGG + Intronic
1032462195 7:132120277-132120299 CAGAGCCTGCAGGGCTGCTGAGG - Intergenic
1033316305 7:140300483-140300505 AACAGCCTCCAGGTCTCCAGTGG + Intronic
1035280566 7:157775771-157775793 CCCAGCCTGCAGGCCTGCGGGGG - Intronic
1035575914 8:704843-704865 CACACCCTCCAGCTCTGCAGTGG - Intronic
1036652706 8:10655310-10655332 CACAGCCTGGGGGCTTGCAGGGG + Intronic
1037537882 8:19843838-19843860 CACTGCCAGCAGCTGTGCAGAGG + Intronic
1038459216 8:27702461-27702483 AACAGCCTTCAGGTTTGCCAGGG + Intergenic
1040432411 8:47356704-47356726 CACAGACAGCACATTTGCAGTGG + Intronic
1041263297 8:56040205-56040227 CACAGGCTGCAGGCTTATAGTGG + Intergenic
1043515121 8:80988991-80989013 CACAGCCTGCACGTTCCAAGAGG + Intronic
1044035573 8:87299107-87299129 AACTGCCTGTGGGTTTGCAGAGG + Intronic
1045469426 8:102497916-102497938 CACAGGCTTGAAGTTTGCAGTGG - Intergenic
1045561818 8:103271432-103271454 TTAAGCCTGCAGGTGTGCAGAGG + Intergenic
1046613729 8:116453265-116453287 CACAGCATACAGGCTTACAGAGG - Intergenic
1047228764 8:122978367-122978389 CACAGACTGGAGGAGTGCAGGGG - Intergenic
1049476851 8:142800931-142800953 CACACCCTGCAGGCTGTCAGTGG - Intergenic
1049578223 8:143399265-143399287 CACAGCCAGCAGGATCACAGGGG - Intergenic
1050621958 9:7463114-7463136 TCCAGGCTGCAGCTTTGCAGGGG + Intergenic
1050745563 9:8871962-8871984 CACAGGCTGCTGGCTTGCAGAGG - Intronic
1052908978 9:33863146-33863168 CACAGGCTGCAGGAGTGCAGTGG - Intronic
1057079671 9:92163488-92163510 CCCGGCATGCAGGTTTTCAGAGG - Intergenic
1057272634 9:93659432-93659454 GACAGCCTGCAAGAATGCAGGGG + Intronic
1057809571 9:98247285-98247307 CACAGGCTGCTGGAATGCAGTGG - Intronic
1059876502 9:118641266-118641288 CACGGTCTGCAGAGTTGCAGGGG - Intergenic
1060111448 9:120909654-120909676 CACTTCCAGCAAGTTTGCAGGGG + Intronic
1060933373 9:127502831-127502853 CACAGCGGGCAGGTGCGCAGTGG - Exonic
1062083374 9:134636179-134636201 CACAGGCTGCAGGCTTGGACTGG + Intergenic
1185533365 X:839371-839393 CACACCCTGCAGGTTTAGAAGGG - Intergenic
1185533442 X:839711-839733 CACACCCTGCAGGTTTAGAAGGG - Intergenic
1185533517 X:840051-840073 CACACCCTGCAGGTTTAGAAGGG - Intergenic
1185533594 X:840391-840413 CACACCCTGCAGGTTTAGAAGGG - Intergenic
1186488571 X:9953175-9953197 TTAAGCCTGCAGGTGTGCAGTGG - Intergenic
1186510815 X:10128585-10128607 CACCGCCTGCAGCTGTGCCGTGG - Exonic
1189569145 X:42276557-42276579 CACAGCCTGCAGGCTGACTGTGG - Intergenic
1190211459 X:48451882-48451904 CAGAGCCTCGAGGTCTGCAGAGG - Intergenic
1196813610 X:119647521-119647543 CCCAGCCTGCAGTAGTGCAGTGG + Intronic
1199798469 X:151226540-151226562 CACAGCCAGCTTGGTTGCAGAGG + Intergenic
1200247168 X:154532345-154532367 CATAGCCCACAGGTATGCAGGGG + Intronic
1200976476 Y:9216996-9217018 CAGAGCCTGCATCTTTGAAGAGG + Intergenic
1201899161 Y:19029568-19029590 CACAGCCTGCAGGAAAGAAGAGG + Intergenic