ID: 1019521952

View in Genome Browser
Species Human (GRCh38)
Location 7:1464845-1464867
Sequence CACAGCAATCAGAGGCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 311}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019521952_1019521959 15 Left 1019521952 7:1464845-1464867 CCAGCCTGCCTCTGATTGCTGTG 0: 1
1: 0
2: 1
3: 40
4: 311
Right 1019521959 7:1464883-1464905 CATGGCACCTCTCTGTTCAGAGG 0: 1
1: 0
2: 0
3: 9
4: 147
1019521952_1019521956 -3 Left 1019521952 7:1464845-1464867 CCAGCCTGCCTCTGATTGCTGTG 0: 1
1: 0
2: 1
3: 40
4: 311
Right 1019521956 7:1464865-1464887 GTGTGTCCTTGGCCAGATCATGG 0: 1
1: 0
2: 0
3: 13
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019521952 Original CRISPR CACAGCAATCAGAGGCAGGC TGG (reversed) Intergenic
900266532 1:1759971-1759993 CACAGCAAGCACAGGATGGCGGG + Intronic
900725217 1:4212018-4212040 CACAGGAATCTGAGGCAAGGAGG - Intergenic
901092456 1:6651102-6651124 GACAGGAAGCAGAGGCTGGCTGG + Intronic
901692963 1:10985732-10985754 CACACCAAACAGAAGCAGGCAGG + Intergenic
901783877 1:11611957-11611979 CACAGCCATGAGATCCAGGCCGG - Intergenic
902210805 1:14903162-14903184 CACAGAAATAAGAGGCGGCCAGG - Intronic
903262597 1:22139486-22139508 CGCTGCACTCAGAGGCAGGCCGG - Intronic
903763138 1:25713180-25713202 CACTGGACTGAGAGGCAGGCAGG - Intronic
904474557 1:30756678-30756700 GACAGGAAGCAGACGCAGGCAGG + Intronic
905768967 1:40625217-40625239 GAAAGCAAGCAGAGGCAGGTGGG + Exonic
906311693 1:44759013-44759035 CACAGCAAACTGAGGCAGTTCGG + Intronic
907865897 1:58398754-58398776 GACAGGAAGCAGAGGAAGGCTGG + Intronic
908947427 1:69516524-69516546 CACAAGAACCAGAGGCAGGAGGG - Intergenic
909282278 1:73770730-73770752 AACAGCAATGGGAGGCAGACAGG + Intergenic
909946580 1:81670616-81670638 CCCACCAATCAGAGGCAGTAAGG + Intronic
910067900 1:83175330-83175352 CAAAGCAATAAGAGGGAGGCAGG + Intergenic
910212651 1:84809403-84809425 CACTGGAATCACATGCAGGCAGG - Intergenic
911193360 1:94969665-94969687 CACAGCATCCAAAGTCAGGCAGG + Intergenic
912455655 1:109795124-109795146 CCCAGCACTCACAGGCAGCCTGG + Intergenic
912635356 1:111286890-111286912 TTCAGCATTCAGAGGGAGGCTGG + Intergenic
914330613 1:146666877-146666899 CCAAGCACACAGAGGCAGGCAGG + Intergenic
914955089 1:152154928-152154950 CACAGCCATGAGAGTCAGGAAGG - Exonic
915971919 1:160361080-160361102 CACAATAGGCAGAGGCAGGCTGG - Intergenic
916679196 1:167088912-167088934 CTCAGCCATCAGATTCAGGCAGG - Intronic
916732505 1:167579300-167579322 CACAGCTTTCCGAGGCAGGTTGG + Intergenic
917173733 1:172207509-172207531 CTCAGCATTCAAAGGTAGGCAGG + Intronic
917634961 1:176926513-176926535 CACAACATTCACAGGCAGACAGG - Intronic
918042542 1:180921992-180922014 CACAGCAATCAGGGCAACGCTGG + Intronic
919535150 1:198778200-198778222 CACAGCAGTCATTGGCTGGCTGG + Intergenic
920811576 1:209290906-209290928 CACATCAAGCAGCAGCAGGCAGG + Intergenic
920841014 1:209553749-209553771 CACAGAGCTCAGAGGCAGGTGGG - Intergenic
921126107 1:212179553-212179575 GACAGGGATCAGAGGCAGGATGG - Intergenic
922606402 1:226892340-226892362 CTCAGGAATCAGAGGAAGCCGGG + Intronic
924482090 1:244444981-244445003 CACAGCAAACTGATCCAGGCAGG + Intronic
924626673 1:245701649-245701671 CACAGCAACTCAAGGCAGGCAGG + Intronic
924636634 1:245793889-245793911 CACATTAATCAGAGGAAAGCTGG - Intronic
1063646622 10:7890193-7890215 CACAGAAAAGAAAGGCAGGCAGG - Intronic
1065398838 10:25272719-25272741 CACAGCAATCAGAGATTGGGTGG + Intronic
1067748197 10:48952348-48952370 CACTGTAATCAGAGGGAGGCTGG - Intronic
1072475502 10:95756175-95756197 CACAGCAAGCAGAGGCTGGGGGG + Intronic
1072624381 10:97101637-97101659 CACAGCTATCAGAGGAGGGCAGG - Intronic
1074370156 10:112894246-112894268 CACAGGAATCAGAGACAGCTAGG - Intergenic
1075886035 10:125900091-125900113 GGCAGCAAGCAGAGGAAGGCAGG + Intronic
1076463977 10:130665956-130665978 TCCAGGAAGCAGAGGCAGGCAGG + Intergenic
1076568276 10:131413467-131413489 CACAGAAGTCAGGGGCAAGCAGG + Intergenic
1077032804 11:477296-477318 CACAGCCTTCAGAGGGAGCCAGG - Intronic
1078002945 11:7512735-7512757 CACAGCCAGCAGGGGAAGGCTGG - Intergenic
1083607704 11:63988640-63988662 CACAGCAATCTGGAGGAGGCAGG - Exonic
1083667474 11:64283750-64283772 GACAGAAATCAGTGACAGGCAGG - Intronic
1084343698 11:68528055-68528077 CAGAGAAAACAGAGACAGGCAGG - Intronic
1084907390 11:72358574-72358596 CACAGCATACACAGACAGGCAGG + Intronic
1086636958 11:89100503-89100525 CACAGGAAATAGAGACAGGCTGG + Intergenic
1087570322 11:99919066-99919088 CACACCAAACAAAGGCAGGAAGG - Intronic
1089067033 11:115670006-115670028 CACAGCAGTCAGGGGCAGCATGG - Intergenic
1089444973 11:118544720-118544742 GACAGCAATCTGAGGCAGGCAGG + Exonic
1089776519 11:120840758-120840780 AACTGCAAACAAAGGCAGGCAGG - Intronic
1090167873 11:124570538-124570560 CACAGCCACCAGCAGCAGGCAGG - Exonic
1090998263 11:131886321-131886343 CACAGGAATTAGAGACAGCCAGG - Intronic
1091697972 12:2640785-2640807 CACAACAATCACAAGCAAGCCGG + Intronic
1092028484 12:5263220-5263242 CACTGCAAGCAGAAGCAGGCAGG + Intergenic
1094710451 12:32956711-32956733 CAGAGCCTACAGAGGCAGGCAGG - Intergenic
1094742166 12:33302239-33302261 CAGAGGAATGAGAGGCAGGAAGG + Intergenic
1094801388 12:34039614-34039636 CACAGCTATCAGAGAATGGCAGG - Intergenic
1095114518 12:38335614-38335636 CACAGCTATCAGAGAATGGCAGG - Intergenic
1100801920 12:98241062-98241084 CAGAGCAAACACAGGCAGACAGG + Intergenic
1101836377 12:108298678-108298700 CACAGCCCATAGAGGCAGGCCGG + Intronic
1102422672 12:112816334-112816356 CATAGAAAACACAGGCAGGCTGG + Intronic
1102455282 12:113067025-113067047 CACAGACAGCAGTGGCAGGCCGG + Intronic
1103017564 12:117507766-117507788 ATCAGCAATCAGCAGCAGGCTGG - Intronic
1104800585 12:131552899-131552921 CAGTGCAATCAGAGTGAGGCTGG + Intergenic
1105975606 13:25469350-25469372 CTCAGGGCTCAGAGGCAGGCTGG - Intronic
1108419229 13:50232075-50232097 CAGAACATTCAGAGGCAGGTAGG - Intronic
1108707472 13:53002668-53002690 CAAAGAAAGCAGTGGCAGGCAGG - Intergenic
1109068949 13:57738045-57738067 CACAGCAATCAGAGAACGACAGG + Intergenic
1109406579 13:61908192-61908214 CACAGCAATCCAGGGCAAGCTGG + Intergenic
1110355620 13:74563448-74563470 CACAGAAATCAGAGGAATACTGG - Intergenic
1111572387 13:90104887-90104909 GGCAGCAGTCAGTGGCAGGCAGG + Intergenic
1112610281 13:100948636-100948658 AACAGCAAACAGAGGTAGGTGGG - Intergenic
1113709920 13:112456450-112456472 GAAAGAAACCAGAGGCAGGCAGG + Intergenic
1115154540 14:30323052-30323074 CAGAGGAAGGAGAGGCAGGCAGG - Intergenic
1119495885 14:75078598-75078620 CAAAGCAAGCTGAGACAGGCTGG + Exonic
1119700674 14:76752494-76752516 TACATCCATCACAGGCAGGCTGG - Intergenic
1120252657 14:82077968-82077990 CTCAACAATCAGAGGGAGGTAGG - Intergenic
1120723921 14:87916776-87916798 CACTGCAAGCAGACGCAGCCAGG + Intronic
1122295054 14:100700812-100700834 CATAGCAAGTAGAGGGAGGCTGG + Intergenic
1122300987 14:100730980-100731002 CACAGCAAGCTAAGGCAGGCTGG - Intronic
1122439870 14:101723359-101723381 CACAGCAGAAAGATGCAGGCTGG - Intergenic
1122461839 14:101902470-101902492 CACGTCCAACAGAGGCAGGCAGG - Intronic
1122707614 14:103630874-103630896 CACAGCACTCAGTGCCAGACAGG - Intronic
1202872040 14_GL000225v1_random:173870-173892 GGCAGCAAGCAGAGGAAGGCAGG - Intergenic
1124148680 15:27156947-27156969 CACATAAGTCACAGGCAGGCAGG - Intronic
1124256947 15:28152039-28152061 CAAAGCAAAGACAGGCAGGCAGG + Intronic
1125476487 15:40051167-40051189 CACAGCCAACAGAGGAAGGAGGG + Intergenic
1128220222 15:65963830-65963852 CACTGCAAGCAGAGGCATGTCGG - Intronic
1128334964 15:66779867-66779889 CACAGCTCTGAGAAGCAGGCAGG - Intronic
1129075815 15:72995030-72995052 AACAGCAATCAAAGGCAAGGAGG - Intergenic
1129288648 15:74546197-74546219 CAAAGCAATCAGTGGGAGGCGGG - Intronic
1129709396 15:77812823-77812845 CACAGCCATCAGGGACAGGGAGG + Intronic
1131502026 15:92977556-92977578 CTGAGCACTCAGACGCAGGCAGG + Intronic
1132901207 16:2255481-2255503 CACAGCAGTGGAAGGCAGGCAGG + Intronic
1133853202 16:9525306-9525328 CACAGCAACCTGAGGGAGGAAGG - Intergenic
1134302146 16:13001288-13001310 CACAATAATTAGGGGCAGGCAGG + Intronic
1135763591 16:25157445-25157467 CACAGGAAGCTGAGGCAGCCTGG + Intronic
1135964041 16:27021306-27021328 CACAGCAGTGAGAGGAAGGATGG - Intergenic
1136079922 16:27845148-27845170 CACAGTGATCACAGGCAGACAGG - Intronic
1136395138 16:29988407-29988429 CAAAGCAGACAGAGGCAGCCTGG - Intronic
1136402318 16:30025330-30025352 CACGGCCAGCAGGGGCAGGCCGG + Exonic
1137559539 16:49493849-49493871 CACAGAAGTCACAGGAAGGCTGG + Intronic
1137832462 16:51557144-51557166 AACTGAAATCAGAGCCAGGCGGG - Intergenic
1138127193 16:54448457-54448479 CGCAGAAAACAGAGGCAGGCAGG - Intergenic
1139283351 16:65788582-65788604 CTCTCCAATCAGGGGCAGGCTGG - Intergenic
1139346575 16:66307634-66307656 CACAGGATTCAGAGGGAGTCAGG + Intergenic
1139633205 16:68243193-68243215 CACAGCCATTAGGGGCAGGATGG - Intergenic
1140002941 16:71044029-71044051 CCAAGCACACAGAGGCAGGCAGG - Intronic
1140121254 16:72084883-72084905 CACAGAAGTCTGAGGCAGGCAGG + Exonic
1140195110 16:72848897-72848919 CCCAGAAATCTCAGGCAGGCAGG + Intronic
1140836229 16:78796751-78796773 CACAGCAATGAGTGGCTGGATGG - Intronic
1141587279 16:85042838-85042860 CGTGGCACTCAGAGGCAGGCAGG + Intronic
1141600283 16:85121711-85121733 CACAGCAAAGTGAGCCAGGCTGG + Intergenic
1141619504 16:85229262-85229284 CCCTGCAGTCAGCGGCAGGCCGG + Intergenic
1142592790 17:1013720-1013742 CCCAGCAATCCCAGGGAGGCAGG - Intronic
1144523260 17:15968476-15968498 GACAGCAAAAAGAGGCATGCTGG - Intronic
1144708002 17:17382500-17382522 CAGAGCACTCAGAGACATGCCGG - Intergenic
1147597158 17:41724639-41724661 CACAGCAGGTAGAGCCAGGCTGG + Exonic
1150135268 17:62691962-62691984 CACAGTAACCAGAGGTAGGATGG + Intronic
1150135446 17:62692713-62692735 CACAGGAACCAGAGGTAGGATGG + Exonic
1151226250 17:72650474-72650496 CACAGGAAACAGAGGCATGAGGG + Intronic
1152218231 17:79046807-79046829 GACAGGGAGCAGAGGCAGGCAGG + Intronic
1152307409 17:79529438-79529460 CACAGCAGACAGAGGGAGACTGG + Intergenic
1152877596 17:82795948-82795970 CACAACCAACAGAGGCAGGCAGG - Intronic
1152945692 17:83196302-83196324 CAGAGCCACCAAAGGCAGGCAGG - Intergenic
1154194278 18:12254430-12254452 CACGGCAATCAGGGGGACGCGGG - Intronic
1154385847 18:13891144-13891166 CACAGGAAGCGGAGGCATGCTGG - Intronic
1156045744 18:32875206-32875228 CACATGAATCAGAGGCATGCAGG - Intergenic
1157287032 18:46384049-46384071 AACAGCAGACAGAGGCAGTCGGG + Intronic
1158765641 18:60447237-60447259 CCCAGCAAGCAGTGGCAGGCTGG - Intergenic
1159830894 18:73277457-73277479 CATAGCATTCAGAGTCAGACAGG + Intergenic
1159960936 18:74555398-74555420 CCGAGCCATCAGAGGCGGGCTGG - Intronic
1160847460 19:1172891-1172913 CCCAGCAGTCACAGGCAGGAAGG + Intronic
1161071924 19:2266723-2266745 GGCGGCCATCAGAGGCAGGCAGG + Intronic
1161717776 19:5886498-5886520 CACAGCAAGTGGAGGGAGGCTGG + Intronic
1161741216 19:6022182-6022204 GACACTAATCCGAGGCAGGCAGG + Intronic
1161977747 19:7615655-7615677 CACAGCAACCCGAGCGAGGCCGG - Exonic
1162795906 19:13087545-13087567 GACAGCCCTCAGAGGGAGGCAGG + Intronic
1163757046 19:19112388-19112410 CACAGCCATCACAGGCTGCCTGG - Exonic
1164236039 19:23335424-23335446 CACAGTCTACAGAGGCAGGCAGG + Intronic
1164987374 19:32658364-32658386 AACAGGAATGAGAAGCAGGCAGG - Intronic
1166291993 19:41869315-41869337 CCCTCCTATCAGAGGCAGGCAGG + Intronic
1167359235 19:49021032-49021054 CAAGCCAATCAAAGGCAGGCAGG - Intergenic
1168575354 19:57504475-57504497 CTGAGCAAGCAGAGGCAGGTAGG - Intronic
1168596880 19:57684546-57684568 CACAGCAACAACAGGCAGGTGGG - Intronic
925453838 2:3996503-3996525 AACACCAATCAGAAGCATGCTGG - Intergenic
925964204 2:9048154-9048176 CACAGCAGTCAGAGGAGGGCTGG + Intergenic
926038530 2:9654440-9654462 CACAGCACACAGAGGCAGCTAGG - Intergenic
926326212 2:11786535-11786557 CACCACAATCAGAAGCAGGCAGG - Intronic
926706534 2:15841566-15841588 CACACCAGTTAGAGGCATGCTGG - Intergenic
927742236 2:25581925-25581947 CCCACCATTCAGAGGCAGGGTGG + Intronic
927856114 2:26528970-26528992 CACAGCCAACAGTGGCAGGCTGG - Intronic
928198488 2:29231784-29231806 CACAGAAATGTGAGACAGGCAGG - Intronic
928437432 2:31264001-31264023 CACAGCAGGCACAGGCAGGCAGG - Intronic
929222190 2:39476238-39476260 AACAGCAAACAGAGGCATCCAGG - Intergenic
929946811 2:46377977-46377999 CACAGCACCCAGAGCGAGGCTGG + Exonic
931627999 2:64274158-64274180 CCCAGTGATCAGAGGCTGGCTGG + Intergenic
931919365 2:66996444-66996466 TACAGCCACCAGAGGCTGGCAGG - Intergenic
932336851 2:70936437-70936459 CCAAGCACTCAGAGTCAGGCGGG + Intronic
932512168 2:72303831-72303853 CACTTCAATCAGAGGCAGCCTGG - Intronic
932595736 2:73092554-73092576 CCCAGCCCTCAGAGGAAGGCGGG + Intronic
932615049 2:73226447-73226469 CCCAGCAAGCAGAGGCGGGCAGG + Exonic
933133928 2:78707723-78707745 CACAGCTGACAGTGGCAGGCAGG - Intergenic
935270139 2:101427396-101427418 CAAAGCCAGCAAAGGCAGGCCGG - Intronic
936050317 2:109217771-109217793 GCCAGCAATCAGATGCAGGCGGG - Intronic
936434591 2:112493277-112493299 CCCAGGAATCAGAGACAGGGAGG - Intronic
938318579 2:130346625-130346647 CTGACCACTCAGAGGCAGGCGGG - Intronic
940031851 2:149272032-149272054 CACAGCAATCAAAGACATGAAGG - Intergenic
940995069 2:160140399-160140421 CAGAGCAAGCAGAGGCATGGCGG + Intronic
941730145 2:168908483-168908505 AACAGGAATCAGATGCAGCCTGG - Intronic
944540046 2:200746023-200746045 CACAGCACTCAGAGGGAACCAGG - Intergenic
944587468 2:201185344-201185366 CAAAGCAATCTGGGGGAGGCAGG - Intronic
948094736 2:235324639-235324661 CCCAGGGATCAAAGGCAGGCAGG + Intergenic
948811913 2:240483089-240483111 AACAGCAATCACAAGAAGGCTGG - Intronic
1168837656 20:888444-888466 CCCAGCAAGCAGAAGCAGGTAGG + Intronic
1168989214 20:2079893-2079915 TATAGCAAACAGAGGCAGGATGG + Intergenic
1171893789 20:30742220-30742242 CAAAGCAGTCAGAGGAAGGTGGG - Intergenic
1172040626 20:32042249-32042271 CACAGCTGTCAGAGGCACACTGG + Intergenic
1172325886 20:34034153-34034175 AGCAGTAAGCAGAGGCAGGCAGG - Intronic
1173712937 20:45176307-45176329 CAAAGCACTCAGAGGCAGTGAGG - Intronic
1174662532 20:52226641-52226663 ATCAGCACTCAGAGGCAGCCTGG - Intergenic
1175042682 20:56070306-56070328 CACAGTAATAATAGGCAGGCAGG + Intergenic
1176423816 21:6535531-6535553 CACAGCTGCCAGAGGCAGGATGG - Intergenic
1178410626 21:32360767-32360789 CTCAGCACTCAGAAGCTGGCTGG + Intronic
1178677389 21:34642750-34642772 CCCAGCACCCAGAGCCAGGCAGG - Intergenic
1179085228 21:38210542-38210564 CACAGCAACCAGAAGCTGGAAGG - Intronic
1179232324 21:39516017-39516039 TACAGTAAACTGAGGCAGGCAGG - Intergenic
1179699309 21:43143846-43143868 CACAGCTGCCAGAGGCAGGATGG - Intergenic
1179980483 21:44893220-44893242 CACAGGCATCAGAGGCTGTCTGG - Intronic
1180087374 21:45514053-45514075 TGCAGGACTCAGAGGCAGGCAGG + Exonic
1180286054 22:10745622-10745644 GGCAGCAAGCAGAGGAAGGCAGG + Intergenic
1180667895 22:17529258-17529280 CAAAGCAAGCACAGGAAGGCTGG + Intronic
1180667905 22:17529315-17529337 CAGAGCAAGCACAGGAAGGCTGG + Intronic
1181925367 22:26354404-26354426 CACAGCATTCAGAGGGAGTGTGG + Intronic
1182895012 22:33852071-33852093 CCCAGCTATTAGAGCCAGGCTGG + Intronic
1183366887 22:37411571-37411593 CACAGCAAGCGGAGGCAGGAAGG + Intronic
1183669729 22:39265337-39265359 CACAGCAGCAAGTGGCAGGCAGG - Intergenic
1184760658 22:46542296-46542318 CACAGCATTTCCAGGCAGGCTGG - Intergenic
1185183972 22:49381607-49381629 CAGAGGAAGCAGAGCCAGGCAGG - Intergenic
950388024 3:12675197-12675219 CACAGGGATGAGGGGCAGGCTGG - Intergenic
950508914 3:13414070-13414092 CACAGGAACAGGAGGCAGGCAGG + Intronic
951145012 3:19216271-19216293 CAGTGCTAGCAGAGGCAGGCTGG + Intronic
953907858 3:46877304-46877326 CAGAGAAATCAGAGGGGGGCTGG - Intronic
954294857 3:49668605-49668627 CACAGTAAACAGAGGCGGGCTGG - Exonic
954955697 3:54516817-54516839 CACTGCTATCAAAGGCAGGGTGG + Intronic
955454051 3:59100804-59100826 GAGAGCAATCAGAAGCAGGGTGG - Intergenic
955751646 3:62189881-62189903 CACAGAAAAGACAGGCAGGCAGG - Intronic
955846289 3:63166751-63166773 CCCAGCACTCAGAGCCAGCCAGG - Intergenic
956558222 3:70544267-70544289 CAGAGAAATCCTAGGCAGGCAGG - Intergenic
958977341 3:100682628-100682650 CCCAGCACTCAGGGGCAGCCTGG - Intronic
960822384 3:121749001-121749023 CCCAGGAATCAGAGGTGGGCAGG - Intronic
961001557 3:123377506-123377528 CACAGCACTCAGAGGGAGGGAGG - Intronic
961507922 3:127383755-127383777 CACAGTAAACAGAGGCAACCGGG - Intergenic
963351072 3:144151723-144151745 CCCTGCACTCACAGGCAGGCAGG - Intergenic
964122172 3:153196329-153196351 CAGAGCACACAGAGGCTGGCAGG + Intergenic
964499779 3:157335942-157335964 AACAGCAGGCAGAGGGAGGCTGG - Intronic
966840126 3:184081472-184081494 AACAGCAGTGAGAGGCAGACAGG + Intergenic
966878673 3:184337626-184337648 CACAGAAATCATAGGCATGCTGG - Exonic
967194229 3:187012724-187012746 GAGAGAAATCACAGGCAGGCTGG - Intronic
967950353 3:194835668-194835690 CACAGGAATCTGTGGCAGCCTGG + Intergenic
967967799 3:194975652-194975674 CACATGACTCACAGGCAGGCAGG + Intergenic
967986105 3:195096325-195096347 CACAGCACTCAGAGGCCTCCAGG + Intronic
970946369 4:21697784-21697806 CAGACCATTCAGAGGGAGGCGGG + Intronic
971258297 4:25032890-25032912 CACAGCAGTAAGTGGCAGGCTGG - Intergenic
971294634 4:25377386-25377408 CACCCCAGTCAGAGGCCGGCAGG - Intronic
971916543 4:32876963-32876985 TACAGGAATCAAAGCCAGGCTGG - Intergenic
975379599 4:73683605-73683627 CACAGCAATCAGGGGAAGTTGGG + Intergenic
977139636 4:93352377-93352399 CCCTGCAATCAGAGCCAGCCAGG + Intronic
977570142 4:98620711-98620733 CACTGCAATCAGAGGGAGTGTGG + Intronic
977916670 4:102601840-102601862 AAAAGCAATCAGGGGCAGGAAGG - Intronic
979245473 4:118499016-118499038 CATAGAACTCAGAGGAAGGCAGG + Intergenic
979303105 4:119110085-119110107 CACAGCAAGGAGAGGGAGTCTGG - Intergenic
979864502 4:125737016-125737038 CACAGGGATCAGATACAGGCAGG + Intergenic
981006077 4:139876695-139876717 CACAGCCATCGGTGGCAGCCTGG - Intronic
983558276 4:169077414-169077436 CACAAAATTCAGAGGCAGGCCGG + Intergenic
985072266 4:186178433-186178455 AACAGCAGTCAGAGGGAGGGGGG + Intergenic
985085381 4:186307871-186307893 CATAGAAATGAGAGGAAGGCAGG + Intergenic
985868052 5:2530780-2530802 CACAGCCACCAGAGGCATGGCGG + Intergenic
986065049 5:4227249-4227271 ATCAGGACTCAGAGGCAGGCAGG - Intergenic
986512017 5:8517428-8517450 CAGAGCAAGCAGAAGCAGGGTGG - Intergenic
988753378 5:34215988-34216010 CACAGTAATCACAGGCTGGTTGG - Intergenic
991741160 5:69676834-69676856 CACAGTAATCACAGGCTGGTTGG - Intergenic
991756458 5:69877608-69877630 CACAGTAATCACAGGCTGGTTGG + Intergenic
991792734 5:70256571-70256593 CACAGTAATCACAGGCTGGTTGG - Intergenic
991820620 5:70552907-70552929 CACAGTAATCACAGGCTGGTTGG - Intergenic
991835860 5:70753521-70753543 CACAGTAATCACAGGCTGGTTGG + Intergenic
991885184 5:71256879-71256901 CACAGTAATCACAGGCTGGTTGG - Intergenic
992679451 5:79139514-79139536 CTCAGGCATCAGATGCAGGCTGG - Intronic
993795932 5:92267967-92267989 CACTGCAAACAGAGGCAGCGAGG - Intergenic
997665552 5:135627202-135627224 GACAGAAATCAGAGGCAAGGGGG - Intergenic
998811728 5:145973210-145973232 CTCAGAAATCAGAGGCAGAAAGG + Intronic
999256447 5:150212264-150212286 CACTGTAATCAGGGCCAGGCTGG - Intronic
999477736 5:151916733-151916755 CACAGCAATGAGAGTCTGTCAGG - Intronic
999773415 5:154792504-154792526 CACAGCATGCAATGGCAGGCTGG - Intronic
1000825289 5:166037266-166037288 CCCAGCAGTCAGAGGGAGGGAGG - Intergenic
1001936688 5:175710451-175710473 CCCAGGAGTCTGAGGCAGGCAGG + Intergenic
1002213099 5:177609900-177609922 CACAGTGATCAGAGAGAGGCTGG + Exonic
1003064374 6:2890775-2890797 CCAAGCAGTCAGAGGCAGGAAGG + Intronic
1003650202 6:7952254-7952276 AACAGCAATGAGGGGCAGGCAGG + Intronic
1004243859 6:13953490-13953512 CACAGAAGTCAAAGGCATGCAGG + Intronic
1005551546 6:26922809-26922831 CACAGTAATCACAGGCTGGTTGG - Intergenic
1006109364 6:31735381-31735403 CGCTGCAATCAGAGGGGGGCTGG + Intronic
1006145996 6:31960083-31960105 CACACCATGCAGAGGCAGCCAGG - Exonic
1007315406 6:40984262-40984284 CACAGAGATGAGAGGCAGGAGGG + Intergenic
1010009393 6:71032694-71032716 CTGAGCCTTCAGAGGCAGGCTGG - Intergenic
1011864562 6:91808047-91808069 GAAATCAATCAGAGGCAGGCAGG - Intergenic
1012490730 6:99780181-99780203 CACTGGAAGCAGAGGCAGGGTGG + Intergenic
1012649980 6:101740691-101740713 CACAAGAAGCAGAGGCTGGCTGG - Intronic
1012926439 6:105272876-105272898 CGCAGCACTGAGAAGCAGGCAGG - Intergenic
1012976981 6:105791419-105791441 CACAGGCAGCAGAGGGAGGCTGG + Intergenic
1013720350 6:113018893-113018915 CACAGGAACCAGAGCCAGGGTGG + Intergenic
1014456070 6:121636338-121636360 CTCAGCAATCAAAGGCAAGGTGG - Intergenic
1014870475 6:126589656-126589678 CACAGAAACCAAAAGCAGGCAGG - Intergenic
1015773713 6:136792966-136792988 CGCAGCACTCAGAGGAGGGCTGG - Intergenic
1016289316 6:142510595-142510617 CACAGCAGTCTGAGGCACACTGG + Intergenic
1016363154 6:143289437-143289459 CACAGCCATTAGGGGAAGGCAGG - Intronic
1017679251 6:156846857-156846879 GACAGGAATCAGAGGGTGGCGGG - Intronic
1018963454 6:168465241-168465263 CACAGAAAGCAGCGGCAGGATGG - Intronic
1019521952 7:1464845-1464867 CACAGCAATCAGAGGCAGGCTGG - Intergenic
1020021830 7:4873866-4873888 CACTCCAACCTGAGGCAGGCTGG + Intronic
1020100532 7:5391891-5391913 GACAGCCCTAAGAGGCAGGCAGG + Intronic
1020982680 7:15091217-15091239 CTTAGCAAACAGAGGCAGGAAGG + Intergenic
1021486398 7:21173032-21173054 TACAGCAATCAGTGCAAGGCGGG - Intergenic
1021496761 7:21283666-21283688 CACAGCTGTGAGAGTCAGGCCGG + Intergenic
1024587349 7:50853633-50853655 CACACCATTCTAAGGCAGGCTGG + Intergenic
1025156118 7:56607056-56607078 CTCAGCCATCAAAGGCAGGGTGG - Intergenic
1025258981 7:57404660-57404682 CCCAGCATGCAGAGCCAGGCCGG - Intergenic
1027129097 7:75578221-75578243 CACAGCAGCGGGAGGCAGGCAGG + Intronic
1027276194 7:76559432-76559454 AAAAGCAATAAGAGGGAGGCAGG - Intergenic
1028879109 7:95859619-95859641 GACAGCTCTCAGTGGCAGGCAGG - Intronic
1029425900 7:100493891-100493913 CACCGCCATCTGAGGCGGGCGGG + Exonic
1029684796 7:102139582-102139604 CACAGAAATTCGAGACAGGCTGG + Intronic
1029991661 7:104967865-104967887 CACAGGAATCTGAGGCAGAGAGG + Intergenic
1030367750 7:108665102-108665124 CACAGCCTTCAGAGGCAGGGAGG + Intergenic
1030413665 7:109213344-109213366 GACAGCCATCAGCAGCAGGCTGG - Intergenic
1032308707 7:130761228-130761250 GACAGCCATCAGAGGCCGGAAGG - Intergenic
1033794425 7:144831028-144831050 CACCGGGATGAGAGGCAGGCTGG - Intronic
1034815899 7:154171663-154171685 CACAGCTCTCAGAGGAGGGCAGG - Intronic
1037032600 8:14127234-14127256 CACAGCTATCAGTGGCAGAACGG - Intronic
1037809725 8:22080377-22080399 CAAAGGAATCAGAGGCAGTCGGG - Intronic
1038800566 8:30744979-30745001 CACTGCAATCAGAGGAGGGTAGG + Intronic
1038971984 8:32646745-32646767 CAAATCAAAGAGAGGCAGGCAGG - Intronic
1038988460 8:32839287-32839309 CACAGCCCCTAGAGGCAGGCTGG + Intergenic
1039365434 8:36923499-36923521 CACAGCATTCAGAAGCAGTGAGG + Intronic
1041164396 8:55076753-55076775 CACAGCAAACAGATTCAGGATGG + Intergenic
1041457018 8:58072008-58072030 CACAGCAGGCAGAGGGAGGGAGG - Intronic
1044251666 8:90009757-90009779 GACTCAAATCAGAGGCAGGCAGG + Intronic
1044893002 8:96857107-96857129 ATTAGCAATCAGAGCCAGGCAGG - Intronic
1045375451 8:101569058-101569080 CACAGAAATGAGAGGCAGGAAGG + Intronic
1045886721 8:107107389-107107411 CTCAGAAATGAGAGGCAGTCAGG - Intergenic
1047472298 8:125188454-125188476 CACAGCAACAATAGGCTGGCAGG - Intronic
1047711919 8:127561103-127561125 CACAACAAGCATAGGGAGGCGGG + Intergenic
1048288101 8:133158138-133158160 CACAGCAGTGAGTGGCAGCCAGG - Intergenic
1048327807 8:133452432-133452454 CACAGGCATCAGAGGGAGGGAGG + Intergenic
1049207621 8:141370775-141370797 CACAGCAGTGAGGGGCAGCCTGG + Intergenic
1049812402 8:144581410-144581432 CACAGCAGTCAGGGGCGGACTGG - Intronic
1051100396 9:13514298-13514320 CGCTGCATTCGGAGGCAGGCAGG - Intergenic
1051999934 9:23266150-23266172 CACAACAGTCAGAGGAATGCTGG - Intergenic
1053442953 9:38130844-38130866 CACAGCTATCAGAGCCGGGCAGG + Intergenic
1054749224 9:68887306-68887328 TACAGCAATGAGTGGTAGGCAGG + Intronic
1056232840 9:84564640-84564662 CACAGCAATCTTAGGAACGCCGG + Intergenic
1056779585 9:89539175-89539197 CAGAGCAAGGAGAGGCAGCCAGG - Intergenic
1057144713 9:92749941-92749963 CACAGCAGTCTGGGCCAGGCTGG + Intronic
1057281038 9:93711663-93711685 CACAGCACGAACAGGCAGGCAGG - Intergenic
1058054304 9:100434156-100434178 AACAGAAAGCAGAGGCAGGTAGG - Intronic
1058627093 9:106945949-106945971 CACAGAAATCCCAGGCAGGTTGG - Intronic
1059181025 9:112212296-112212318 CACAGCAATAAGAGGCATGGGGG + Intergenic
1059737799 9:117119725-117119747 CCCATCTATCAGAGGAAGGCTGG - Intronic
1061306855 9:129737312-129737334 CAAAACAATCCGAGGCAGGAGGG - Intergenic
1061394642 9:130337345-130337367 GACTGCAGTCAGAGTCAGGCCGG + Intronic
1061954574 9:133955169-133955191 CACAGGAAGCAGAGTCTGGCTGG - Intronic
1062042837 9:134412005-134412027 CCCAGCACCCAGACGCAGGCCGG - Intronic
1062043073 9:134412907-134412929 CACAGGAAGCAAAGGCAGGCAGG - Intronic
1187503491 X:19859605-19859627 CACACCACCCAGAGCCAGGCAGG - Intronic
1187657073 X:21488438-21488460 CACAGCAATCATTGGCAGTGTGG + Intronic
1188276478 X:28207292-28207314 CAGAGCCTACAGAGGCAGGCAGG - Intergenic
1188446635 X:30259608-30259630 CACAGCAATCTCTGGGAGGCGGG - Intergenic
1189181041 X:39004687-39004709 CACAGCATTCAGCAGCGGGCAGG - Intergenic
1190525975 X:51330273-51330295 GACAGCAATGTGAGGAAGGCTGG - Intergenic
1192594862 X:72395682-72395704 CACTGTAATCAAAGGCAGTCTGG + Intronic
1198006064 X:132494198-132494220 CACATCAATGAGAGGCAGTGTGG - Intergenic
1198278141 X:135116907-135116929 CACAGGAATCAGAGGCTGACTGG - Intergenic
1198292821 X:135255609-135255631 CACAGGAATCAGAGGCTGACTGG + Intronic
1199506767 X:148571298-148571320 CACAGTAATCATAGGCAGGAGGG - Intronic
1199794748 X:151183287-151183309 CACAGGAGTGAGAGGCAGGAGGG + Intergenic
1200120604 X:153788534-153788556 CACCACACTCAGAGGCAGGCGGG + Intronic
1202628541 Y:56884895-56884917 GGCAGCAAGCAGAGGAAGGCAGG - Intergenic