ID: 1019522720

View in Genome Browser
Species Human (GRCh38)
Location 7:1467970-1467992
Sequence CAAGAGGCCCAGAGGGTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019522713_1019522720 8 Left 1019522713 7:1467939-1467961 CCTGGGCGGGAGTGAACACAGGC No data
Right 1019522720 7:1467970-1467992 CAAGAGGCCCAGAGGGTCCCAGG No data
1019522710_1019522720 20 Left 1019522710 7:1467927-1467949 CCTCTGCTGCCTCCTGGGCGGGA No data
Right 1019522720 7:1467970-1467992 CAAGAGGCCCAGAGGGTCCCAGG No data
1019522711_1019522720 11 Left 1019522711 7:1467936-1467958 CCTCCTGGGCGGGAGTGAACACA No data
Right 1019522720 7:1467970-1467992 CAAGAGGCCCAGAGGGTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019522720 Original CRISPR CAAGAGGCCCAGAGGGTCCC AGG Intergenic
No off target data available for this crispr