ID: 1019522735

View in Genome Browser
Species Human (GRCh38)
Location 7:1468021-1468043
Sequence ATGGGGAAGGAGGATGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019522735_1019522749 9 Left 1019522735 7:1468021-1468043 CCCTCCCCATCCTCCTTCCCCAT No data
Right 1019522749 7:1468053-1468075 ACGACCCCAGCCAACGTCCTGGG No data
1019522735_1019522750 10 Left 1019522735 7:1468021-1468043 CCCTCCCCATCCTCCTTCCCCAT No data
Right 1019522750 7:1468054-1468076 CGACCCCAGCCAACGTCCTGGGG No data
1019522735_1019522756 26 Left 1019522735 7:1468021-1468043 CCCTCCCCATCCTCCTTCCCCAT No data
Right 1019522756 7:1468070-1468092 CCTGGGGCTCTACCTGTCACAGG No data
1019522735_1019522748 8 Left 1019522735 7:1468021-1468043 CCCTCCCCATCCTCCTTCCCCAT No data
Right 1019522748 7:1468052-1468074 CACGACCCCAGCCAACGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019522735 Original CRISPR ATGGGGAAGGAGGATGGGGA GGG (reversed) Intergenic
No off target data available for this crispr