ID: 1019522749

View in Genome Browser
Species Human (GRCh38)
Location 7:1468053-1468075
Sequence ACGACCCCAGCCAACGTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019522744_1019522749 -9 Left 1019522744 7:1468039-1468061 CCCATGCCTGGTCCACGACCCCA No data
Right 1019522749 7:1468053-1468075 ACGACCCCAGCCAACGTCCTGGG No data
1019522735_1019522749 9 Left 1019522735 7:1468021-1468043 CCCTCCCCATCCTCCTTCCCCAT No data
Right 1019522749 7:1468053-1468075 ACGACCCCAGCCAACGTCCTGGG No data
1019522738_1019522749 4 Left 1019522738 7:1468026-1468048 CCCATCCTCCTTCCCCATGCCTG No data
Right 1019522749 7:1468053-1468075 ACGACCCCAGCCAACGTCCTGGG No data
1019522742_1019522749 -4 Left 1019522742 7:1468034-1468056 CCTTCCCCATGCCTGGTCCACGA No data
Right 1019522749 7:1468053-1468075 ACGACCCCAGCCAACGTCCTGGG No data
1019522743_1019522749 -8 Left 1019522743 7:1468038-1468060 CCCCATGCCTGGTCCACGACCCC No data
Right 1019522749 7:1468053-1468075 ACGACCCCAGCCAACGTCCTGGG No data
1019522731_1019522749 23 Left 1019522731 7:1468007-1468029 CCCTGCCCTCAGCACCCTCCCCA No data
Right 1019522749 7:1468053-1468075 ACGACCCCAGCCAACGTCCTGGG No data
1019522736_1019522749 8 Left 1019522736 7:1468022-1468044 CCTCCCCATCCTCCTTCCCCATG No data
Right 1019522749 7:1468053-1468075 ACGACCCCAGCCAACGTCCTGGG No data
1019522733_1019522749 18 Left 1019522733 7:1468012-1468034 CCCTCAGCACCCTCCCCATCCTC No data
Right 1019522749 7:1468053-1468075 ACGACCCCAGCCAACGTCCTGGG No data
1019522741_1019522749 -1 Left 1019522741 7:1468031-1468053 CCTCCTTCCCCATGCCTGGTCCA No data
Right 1019522749 7:1468053-1468075 ACGACCCCAGCCAACGTCCTGGG No data
1019522737_1019522749 5 Left 1019522737 7:1468025-1468047 CCCCATCCTCCTTCCCCATGCCT No data
Right 1019522749 7:1468053-1468075 ACGACCCCAGCCAACGTCCTGGG No data
1019522734_1019522749 17 Left 1019522734 7:1468013-1468035 CCTCAGCACCCTCCCCATCCTCC No data
Right 1019522749 7:1468053-1468075 ACGACCCCAGCCAACGTCCTGGG No data
1019522739_1019522749 3 Left 1019522739 7:1468027-1468049 CCATCCTCCTTCCCCATGCCTGG No data
Right 1019522749 7:1468053-1468075 ACGACCCCAGCCAACGTCCTGGG No data
1019522745_1019522749 -10 Left 1019522745 7:1468040-1468062 CCATGCCTGGTCCACGACCCCAG No data
Right 1019522749 7:1468053-1468075 ACGACCCCAGCCAACGTCCTGGG No data
1019522732_1019522749 22 Left 1019522732 7:1468008-1468030 CCTGCCCTCAGCACCCTCCCCAT No data
Right 1019522749 7:1468053-1468075 ACGACCCCAGCCAACGTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019522749 Original CRISPR ACGACCCCAGCCAACGTCCT GGG Intergenic
No off target data available for this crispr