ID: 1019522756

View in Genome Browser
Species Human (GRCh38)
Location 7:1468070-1468092
Sequence CCTGGGGCTCTACCTGTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019522751_1019522756 -10 Left 1019522751 7:1468057-1468079 CCCCAGCCAACGTCCTGGGGCTC No data
Right 1019522756 7:1468070-1468092 CCTGGGGCTCTACCTGTCACAGG No data
1019522743_1019522756 9 Left 1019522743 7:1468038-1468060 CCCCATGCCTGGTCCACGACCCC No data
Right 1019522756 7:1468070-1468092 CCTGGGGCTCTACCTGTCACAGG No data
1019522747_1019522756 -4 Left 1019522747 7:1468051-1468073 CCACGACCCCAGCCAACGTCCTG No data
Right 1019522756 7:1468070-1468092 CCTGGGGCTCTACCTGTCACAGG No data
1019522735_1019522756 26 Left 1019522735 7:1468021-1468043 CCCTCCCCATCCTCCTTCCCCAT No data
Right 1019522756 7:1468070-1468092 CCTGGGGCTCTACCTGTCACAGG No data
1019522745_1019522756 7 Left 1019522745 7:1468040-1468062 CCATGCCTGGTCCACGACCCCAG No data
Right 1019522756 7:1468070-1468092 CCTGGGGCTCTACCTGTCACAGG No data
1019522736_1019522756 25 Left 1019522736 7:1468022-1468044 CCTCCCCATCCTCCTTCCCCATG No data
Right 1019522756 7:1468070-1468092 CCTGGGGCTCTACCTGTCACAGG No data
1019522744_1019522756 8 Left 1019522744 7:1468039-1468061 CCCATGCCTGGTCCACGACCCCA No data
Right 1019522756 7:1468070-1468092 CCTGGGGCTCTACCTGTCACAGG No data
1019522742_1019522756 13 Left 1019522742 7:1468034-1468056 CCTTCCCCATGCCTGGTCCACGA No data
Right 1019522756 7:1468070-1468092 CCTGGGGCTCTACCTGTCACAGG No data
1019522739_1019522756 20 Left 1019522739 7:1468027-1468049 CCATCCTCCTTCCCCATGCCTGG No data
Right 1019522756 7:1468070-1468092 CCTGGGGCTCTACCTGTCACAGG No data
1019522738_1019522756 21 Left 1019522738 7:1468026-1468048 CCCATCCTCCTTCCCCATGCCTG No data
Right 1019522756 7:1468070-1468092 CCTGGGGCTCTACCTGTCACAGG No data
1019522737_1019522756 22 Left 1019522737 7:1468025-1468047 CCCCATCCTCCTTCCCCATGCCT No data
Right 1019522756 7:1468070-1468092 CCTGGGGCTCTACCTGTCACAGG No data
1019522746_1019522756 2 Left 1019522746 7:1468045-1468067 CCTGGTCCACGACCCCAGCCAAC No data
Right 1019522756 7:1468070-1468092 CCTGGGGCTCTACCTGTCACAGG No data
1019522741_1019522756 16 Left 1019522741 7:1468031-1468053 CCTCCTTCCCCATGCCTGGTCCA No data
Right 1019522756 7:1468070-1468092 CCTGGGGCTCTACCTGTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019522756 Original CRISPR CCTGGGGCTCTACCTGTCAC AGG Intergenic
No off target data available for this crispr