ID: 1019524011

View in Genome Browser
Species Human (GRCh38)
Location 7:1472695-1472717
Sequence CTGCGGTGCCGTGTCACCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019524002_1019524011 25 Left 1019524002 7:1472647-1472669 CCTTGGGACCCGGGCCTGGCGCT 0: 1
1: 0
2: 1
3: 20
4: 222
Right 1019524011 7:1472695-1472717 CTGCGGTGCCGTGTCACCTCAGG No data
1019524000_1019524011 27 Left 1019524000 7:1472645-1472667 CCCCTTGGGACCCGGGCCTGGCG No data
Right 1019524011 7:1472695-1472717 CTGCGGTGCCGTGTCACCTCAGG No data
1019524001_1019524011 26 Left 1019524001 7:1472646-1472668 CCCTTGGGACCCGGGCCTGGCGC No data
Right 1019524011 7:1472695-1472717 CTGCGGTGCCGTGTCACCTCAGG No data
1019524005_1019524011 16 Left 1019524005 7:1472656-1472678 CCGGGCCTGGCGCTCTTCCGGCG No data
Right 1019524011 7:1472695-1472717 CTGCGGTGCCGTGTCACCTCAGG No data
1019524009_1019524011 -1 Left 1019524009 7:1472673-1472695 CCGGCGGCACAGGAGAGACGTGC No data
Right 1019524011 7:1472695-1472717 CTGCGGTGCCGTGTCACCTCAGG No data
1019524004_1019524011 17 Left 1019524004 7:1472655-1472677 CCCGGGCCTGGCGCTCTTCCGGC 0: 1
1: 0
2: 0
3: 13
4: 214
Right 1019524011 7:1472695-1472717 CTGCGGTGCCGTGTCACCTCAGG No data
1019524007_1019524011 11 Left 1019524007 7:1472661-1472683 CCTGGCGCTCTTCCGGCGGCACA 0: 1
1: 0
2: 1
3: 2
4: 52
Right 1019524011 7:1472695-1472717 CTGCGGTGCCGTGTCACCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019524011 Original CRISPR CTGCGGTGCCGTGTCACCTC AGG Intronic