ID: 1019524414

View in Genome Browser
Species Human (GRCh38)
Location 7:1474341-1474363
Sequence CAGGCACCTGCCCATGATCG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 220}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019524414_1019524419 -8 Left 1019524414 7:1474341-1474363 CCGCGATCATGGGCAGGTGCCTG 0: 1
1: 0
2: 0
3: 9
4: 220
Right 1019524419 7:1474356-1474378 GGTGCCTGCGGGCGCGGTGAGGG 0: 1
1: 0
2: 0
3: 12
4: 194
1019524414_1019524418 -9 Left 1019524414 7:1474341-1474363 CCGCGATCATGGGCAGGTGCCTG 0: 1
1: 0
2: 0
3: 9
4: 220
Right 1019524418 7:1474355-1474377 AGGTGCCTGCGGGCGCGGTGAGG 0: 1
1: 0
2: 1
3: 15
4: 200
1019524414_1019524428 24 Left 1019524414 7:1474341-1474363 CCGCGATCATGGGCAGGTGCCTG 0: 1
1: 0
2: 0
3: 9
4: 220
Right 1019524428 7:1474388-1474410 CCCCGGCCGGCGGGCTCACCTGG 0: 1
1: 0
2: 4
3: 10
4: 172
1019524414_1019524421 7 Left 1019524414 7:1474341-1474363 CCGCGATCATGGGCAGGTGCCTG 0: 1
1: 0
2: 0
3: 9
4: 220
Right 1019524421 7:1474371-1474393 GGTGAGGGCCCAGTCAGCCCCGG 0: 1
1: 0
2: 4
3: 35
4: 291
1019524414_1019524425 15 Left 1019524414 7:1474341-1474363 CCGCGATCATGGGCAGGTGCCTG 0: 1
1: 0
2: 0
3: 9
4: 220
Right 1019524425 7:1474379-1474401 CCCAGTCAGCCCCGGCCGGCGGG 0: 1
1: 0
2: 0
3: 29
4: 187
1019524414_1019524423 14 Left 1019524414 7:1474341-1474363 CCGCGATCATGGGCAGGTGCCTG 0: 1
1: 0
2: 0
3: 9
4: 220
Right 1019524423 7:1474378-1474400 GCCCAGTCAGCCCCGGCCGGCGG 0: 1
1: 0
2: 0
3: 9
4: 202
1019524414_1019524422 11 Left 1019524414 7:1474341-1474363 CCGCGATCATGGGCAGGTGCCTG 0: 1
1: 0
2: 0
3: 9
4: 220
Right 1019524422 7:1474375-1474397 AGGGCCCAGTCAGCCCCGGCCGG 0: 1
1: 0
2: 1
3: 20
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019524414 Original CRISPR CAGGCACCTGCCCATGATCG CGG (reversed) Exonic
900665309 1:3811113-3811135 CAGGCACCTGCCCCTAAATGGGG - Intergenic
904210988 1:28887024-28887046 CAGGCAACTGCCGATCAGCGGGG - Intergenic
906062882 1:42959701-42959723 CAGGAACTCGCCCAGGATCGCGG - Intergenic
907842597 1:58171710-58171732 CAGGCACTGGCCCAAGATCTAGG + Intronic
908300661 1:62758336-62758358 CAGGCACTGGCCCAAGATCTAGG + Intergenic
911751648 1:101502967-101502989 CAGGCACTGGCCCAAGATCTAGG + Intergenic
912021540 1:105113099-105113121 CAGGCACTGGCCCAAGATCTAGG + Intergenic
915163809 1:153937217-153937239 AGGGCACCTGCCCATGCTCAAGG - Intronic
915999643 1:160602741-160602763 CAGGCACCTGCCACTGTTCCTGG + Intergenic
916083916 1:161254452-161254474 CAGGCACTGGCCCAAGATCTAGG + Intergenic
916939781 1:169666089-169666111 CAGGCACTGGCCCAAGATCTAGG + Intronic
917086370 1:171308920-171308942 CAGGCACGGGCCCAAGATCTAGG + Intergenic
917280133 1:173371937-173371959 CAGGCACTGGCCCAAGATCTAGG + Intergenic
917968917 1:180195057-180195079 CAGGCGCCTGCACTTGGTCGTGG + Intronic
919206524 1:194426073-194426095 CAGGCACTGGCCCAAGATCTAGG + Intergenic
919558945 1:199094604-199094626 CAGGCACTGGCCCAAGATCTAGG + Intergenic
922182292 1:223244725-223244747 TGGGCACCTGCCTATGATTGCGG - Intronic
924068640 1:240253965-240253987 CAAGCACCTGCCAGTGATTGAGG - Intronic
1062951262 10:1505655-1505677 CAGCCACCTCCCCATGCCCGTGG + Intronic
1063321455 10:5056169-5056191 CAGGCACTGGCCCAAGATCTAGG - Intronic
1063750151 10:8934801-8934823 CAGCCACCTGCCCAGGAGAGAGG - Intergenic
1064603312 10:17014768-17014790 CAGGCACTGGCCCAAGATCTAGG - Intronic
1068500563 10:57836754-57836776 CAGGCACTGGCCCAAGATCTAGG + Intergenic
1069137088 10:64780739-64780761 CAGGCACTGGCCCAAGATCTAGG - Intergenic
1069545547 10:69325498-69325520 CAGGCACCAGCCAATGCTCCTGG + Intronic
1071495148 10:86162923-86162945 CAGGCCCATGCCCATGATGATGG - Intronic
1075146577 10:119887554-119887576 CAGGCACTTGCCCAAGATCTAGG + Intronic
1075831396 10:125414582-125414604 CAGGCACTGGACCATGATGGGGG + Intergenic
1076825174 10:132963572-132963594 CTGGCACCTGCTCAGCATCGGGG + Intergenic
1079811412 11:25003239-25003261 CAGGCACTGGCCCAAGATCTAGG - Intronic
1083881501 11:65551181-65551203 CAGGAACCAGCGCATGGTCGGGG + Exonic
1084155520 11:67310731-67310753 CTGGAACCTGCCCGCGATCGAGG - Intronic
1086317649 11:85610563-85610585 CAGGCACTGGCCCAAGATCTAGG + Intronic
1087131162 11:94670556-94670578 CAGGCCCCTCCCCAAGATTGAGG - Intergenic
1087683084 11:101236597-101236619 CAGGCACTGGCCCAAGATCTAGG - Intergenic
1091901448 12:4147323-4147345 CAAGCACCTGCCCATGCGAGAGG + Intergenic
1092472576 12:8792339-8792361 CAGGCACTGGCCCAAGATCTAGG + Intergenic
1093345507 12:18035349-18035371 CAGGCACGGGCCCAAGATCTAGG + Intergenic
1095277654 12:40307922-40307944 CAGGCACCTGCCACTGTTCCCGG + Intronic
1096486050 12:51982045-51982067 CAGGCACCTCCCTATGTTTGAGG + Intronic
1097967734 12:65598574-65598596 CTGGCAACTACCCATGATTGAGG + Intergenic
1100210054 12:92390668-92390690 CAGGCACTGGCCCAAGATCTAGG + Intergenic
1101427341 12:104598973-104598995 CAGGCACTTGGCCATGGTCAAGG - Intronic
1103825787 12:123736926-123736948 CAGGCACCTGCCTATCCTGGTGG - Intronic
1104767358 12:131338909-131338931 CAGGCACTGGCCCAAGATCTAGG + Intergenic
1104855590 12:131900960-131900982 CAGGCCCCTGCCCAGGAGCTGGG - Intronic
1106431863 13:29688284-29688306 CCGGCACCTGACCATCATGGAGG - Intergenic
1106812036 13:33368221-33368243 CAGGCACTGGGCCAGGATCGAGG - Intergenic
1111470406 13:88673783-88673805 CAGGCACCTGCCAATGCTTCCGG + Intergenic
1113808140 13:113121829-113121851 CAGCCACCTGCACATGAGCCTGG - Intergenic
1114058573 14:18998981-18999003 CAGGCACCAGAACATGATGGGGG + Intronic
1114103974 14:19402773-19402795 CAGGCACCAGAACATGATGGGGG - Exonic
1115285199 14:31707874-31707896 CAGGCACTGGCCCAAGATCTAGG - Intronic
1115494332 14:33987312-33987334 TAGGCACCTGCCCATTATTTTGG - Intronic
1116942816 14:50808140-50808162 CAGGCACCTGCTGAAGATCCAGG + Intronic
1118180037 14:63483539-63483561 CAGGCAGCTCCCCATGAACTGGG + Intronic
1118492572 14:66275688-66275710 AAGGAACCTGCCCAAGATCATGG - Intergenic
1123964345 15:25439477-25439499 CAGGCACCTGCCCCGCCTCGGGG - Intergenic
1124125515 15:26935533-26935555 CAGGCACGTGCCCCTGGTCTCGG + Intronic
1124616725 15:31247604-31247626 AAGGCACCTGCTCATGTTGGGGG + Intergenic
1128115534 15:65102537-65102559 CAGGCGCCAGCCCATGTTCGGGG + Exonic
1129110401 15:73333861-73333883 CAGGAACTTGCCCAAGATCACGG + Intronic
1129685872 15:77685934-77685956 TAGGGACCTGCTCAGGATCGTGG - Intronic
1130003562 15:80069749-80069771 CAGGCACCTGCCACTGCACGAGG + Intronic
1132669356 16:1096356-1096378 CAGCCCCGTGCCCATGAGCGGGG + Intergenic
1133177815 16:4028925-4028947 CAGGCACCTGCCACTGCACGCGG + Intronic
1136042826 16:27593863-27593885 CAGGCACCTTCTCCTGATCCAGG + Intronic
1137644069 16:50059096-50059118 CGGGCACCAGCTCATGATGGTGG - Intergenic
1138494407 16:57398863-57398885 CAGGCACTGGCCCAAGATCTCGG - Intergenic
1139137501 16:64222625-64222647 CAGGCACCTGCCAATAAGCCCGG + Intergenic
1142651489 17:1356024-1356046 CAGGCACCTGCCACTGCTCCCGG - Intronic
1145804363 17:27715849-27715871 CAGGCACTGGCCCAAGATCTAGG + Intergenic
1149010684 17:51853505-51853527 GAGGCACTTGCCCATGATGTTGG + Intronic
1149213495 17:54329216-54329238 CAGGCACTGGCCCAAGATCTAGG + Intergenic
1151278996 17:73057792-73057814 CAGGCACCTACCAATGTTCCCGG - Intronic
1151405687 17:73884717-73884739 CAGGCAGCTTCCCATGATGCTGG - Intergenic
1151568283 17:74912422-74912444 CAGGCACTGGCCCAAGATCTAGG + Intergenic
1152429991 17:80243538-80243560 CAGGCACCTGCCCCTGAGCCTGG + Intronic
1152574608 17:81134548-81134570 CAGGCCCCTGCCCCTGCTCTGGG + Intronic
1152634876 17:81426833-81426855 GAGGAAACTGCCCATGAACGAGG - Exonic
1152641038 17:81449312-81449334 CAGAGACCTGCCCATTAACGGGG - Intronic
1152678135 17:81651932-81651954 CACGCACCTGCCCAGCATCCTGG - Intronic
1157857309 18:51114794-51114816 CAGGCACTGGCCCAAGATCTAGG - Intergenic
1165847338 19:38826777-38826799 CAGGCACTGGCCCAAGATCTAGG + Intronic
1165867161 19:38945923-38945945 CAGGCACCTGCCCTGCATTGTGG - Intronic
925949638 2:8898645-8898667 CAGGCACTGGCCCAAGATCTAGG - Intronic
927914620 2:26927171-26927193 CAGGCACCGGCCCAGCATGGGGG - Intronic
928617363 2:33053922-33053944 CAGGCACTGGCCCAAGATCTAGG - Intronic
930038787 2:47104653-47104675 CAGGCACTGGCCCAAGATCTAGG + Intronic
932417942 2:71584996-71585018 CAGGTACCTGCCAAGGACCGTGG + Intronic
932745217 2:74328379-74328401 AAGGCATCTGCCTATGATCATGG - Intronic
934220906 2:90081848-90081870 CAAGCAACTGCCCATGTTCATGG - Intergenic
934867377 2:97825161-97825183 CAGGCACTGGCCCATGATCTAGG + Intronic
935205977 2:100896727-100896749 CACAAACCTCCCCATGATCGTGG - Intronic
936802309 2:116284032-116284054 CAGGCACTGGCCCAAGATCTAGG + Intergenic
938137816 2:128773835-128773857 GAGGCCACTGCCCATGATCCAGG - Intergenic
938477040 2:131626252-131626274 CAGGCACCAGGGCATGATGGAGG + Intergenic
939521436 2:143235968-143235990 GAGGCACCTGACCATGTTCATGG + Intronic
939852105 2:147315437-147315459 CAGGCACAGGCCCAAGATCTAGG + Intergenic
943134003 2:183889499-183889521 CAGGCACTGGCCCAAGATCTAGG + Intergenic
946207117 2:218117878-218117900 CAGGCACTGGCCCAAGATCTAGG - Intergenic
1171100548 20:22379658-22379680 CAGGCAACTGCCCATGGCCCTGG + Intergenic
1175886867 20:62297100-62297122 CAGGCACCTCCCCACGACCAAGG - Intergenic
1176176670 20:63730278-63730300 CAGGGCCCTGCCAATGACCGGGG - Intronic
1178404042 21:32310320-32310342 CTGACACCTTCCCATGATGGGGG + Intronic
1180477058 22:15721600-15721622 CAGGCACCAGAACATGATGGGGG + Intronic
1182773562 22:32813758-32813780 CAGGCAACTAGCCATGAACGAGG - Intronic
1183705024 22:39470829-39470851 CAGTGACCTGCCCAAGATCACGG + Intronic
1183910448 22:41075104-41075126 CAGGCACCAGGTCATGATGGTGG - Intergenic
1185293464 22:50040812-50040834 CCGGCACCTGCTCATGCTCCGGG + Intronic
951020733 3:17778503-17778525 CAGGCACTGGCCCAAGATCGAGG + Intronic
951191120 3:19772689-19772711 CAGGAAACTTCCCATGATGGTGG - Intergenic
951317215 3:21202918-21202940 CAAGAACCTGCCCATAATCCTGG - Intergenic
951789222 3:26461131-26461153 CAGGCACCTGCCCATGAAATTGG + Intergenic
952453283 3:33450704-33450726 CAGGCACTGGCCCAAGATCTAGG + Intergenic
953070601 3:39515712-39515734 AAGGCACCTGGCCAAGATCTTGG - Exonic
953201677 3:40783385-40783407 CAGGTAGCTGCCCATTATCCAGG - Intergenic
953673522 3:44982303-44982325 CAGGCACCTACCCCTGGTCCTGG + Intronic
957045540 3:75371216-75371238 CAGGAACCTGCTCATCATCCTGG - Intergenic
962885906 3:139627643-139627665 CATGCACCTGCGCATGTTTGAGG - Intronic
963632850 3:147755204-147755226 CAGGCACCTGGGCATTATGGGGG + Intergenic
964064749 3:152563888-152563910 CAGGCACTGGCCCAAGATCTAGG + Intergenic
965139438 3:164815549-164815571 CAGGCACTGGCCCAAGATCTAGG + Intergenic
967583906 3:191189825-191189847 CAGGCACTGGCCCAAGATCTAGG + Intergenic
968113831 3:196073507-196073529 CAGGCAGTTACCCATGATCAAGG + Intronic
970079800 4:12269314-12269336 CAGGCACCTGCCACTGCTCTTGG - Intergenic
973046089 4:45535499-45535521 CAGGCACTGGCCCAAGATCTAGG + Intergenic
974174748 4:58308419-58308441 CAGGCACTGGCCCAAGATCTAGG + Intergenic
974526791 4:63056913-63056935 CAGGCACTGGCCCAAGATCTAGG + Intergenic
974537363 4:63188700-63188722 CAGGCACTGGCCCAAGATCTAGG + Intergenic
974838618 4:67278238-67278260 CAGGCACTGGCCCAAGATCTAGG - Intergenic
975595582 4:76046118-76046140 CAGGCACTGGCCCAGGATCTAGG - Intronic
977884324 4:102239367-102239389 CAGGCACTGGCCCAAGATCTAGG + Intergenic
983834705 4:172373123-172373145 CAGGCACTGGCCCAAGATCTAGG - Intronic
984708191 4:182863061-182863083 CAGCCACCTGCCCATCAGCCGGG - Intergenic
987545006 5:19303277-19303299 CAGGCACTGGCCCAAGATCTAGG - Intergenic
987818100 5:22930180-22930202 CAGGCACTGGCCCAAGATCTAGG + Intergenic
988358023 5:30201674-30201696 CAGGCACTAGCCCAAGATCTAGG + Intergenic
988591772 5:32555793-32555815 CAGGCACTGGCCCAAGATCTAGG - Intronic
989496413 5:42114928-42114950 CAGGCACTGGCCCAGGATCTAGG + Intergenic
989957574 5:50374404-50374426 CAGGCACAGGCCCAAGATCTAGG + Intergenic
994231504 5:97314206-97314228 CAGGCACTGGCCCAAGATCTAGG - Intergenic
994454250 5:99984693-99984715 CAGGCACTGGCCCAAGATCTAGG + Intergenic
997758301 5:136421042-136421064 AAAGCACATGCCCAGGATCGTGG + Intergenic
998111689 5:139507392-139507414 CAGGCACTGGCCCAAGATCTAGG + Intergenic
999768273 5:154756369-154756391 CAGGGACCTGCCCCTGCCCGAGG + Intronic
1000085463 5:157884126-157884148 CAGGCACTGGCCCAAGATCTAGG + Intergenic
1000795191 5:165656239-165656261 CAGGCATCTGCCCATGCCCAAGG + Intergenic
1002484080 5:179523007-179523029 GAGGCACCTGCCCAGGAAGGCGG - Intergenic
1002500485 5:179644474-179644496 GAGGCACCTGCCCAGGAAGGCGG + Intronic
1005013415 6:21356974-21356996 CAGGCACCTGGCCATGGTCAGGG - Intergenic
1007916507 6:45566392-45566414 CAGGGACCTGCCCAGAATCAAGG + Intronic
1008169319 6:48183154-48183176 CAGGCTCTTTCCCATGATTGGGG + Intergenic
1009471034 6:64028695-64028717 CAGGCACTGGCCCAAGATCTAGG + Intronic
1011374824 6:86677318-86677340 CAGGCACTGGCCCAAGATCTAGG - Intergenic
1012441319 6:99264738-99264760 CAGGCACTGGCCCAAGATCTAGG - Intergenic
1013907622 6:115237081-115237103 CAGGCACTGGCCCAAGATCTAGG - Intergenic
1014265280 6:119269708-119269730 CAGGCAGCTGCCAAAGATGGAGG - Intronic
1015184339 6:130396759-130396781 AAGGCACCTACCCATCATCCAGG + Intronic
1016184240 6:141180223-141180245 CAGGCACTGGCCCAAGATCTAGG + Intergenic
1016920140 6:149284713-149284735 CAGGCAACTGCCCATGAGTTGGG - Intronic
1017101179 6:150851112-150851134 CAGGCACTGGCCCAAGATCTAGG + Intergenic
1017689373 6:156948030-156948052 CAGGCACCTGCTCCTGAGCATGG + Intronic
1018918395 6:168152901-168152923 CAGGCAGCAGGTCATGATCGTGG - Intergenic
1019524414 7:1474341-1474363 CAGGCACCTGCCCATGATCGCGG - Exonic
1021756502 7:23858033-23858055 CAGGCACTAGCCCAAGATCTAGG - Intergenic
1022442934 7:30448573-30448595 CCTGCACCAGCCCATGAGCGAGG + Intronic
1024870565 7:53958640-53958662 CAGGCACTGGCCCAAGATCTAGG - Intergenic
1024899578 7:54303346-54303368 CAGGCACCTGCCACTGCACGTGG - Intergenic
1025955616 7:66180627-66180649 CAGGCACCTGCCCCTGCACCTGG + Intergenic
1028495007 7:91452262-91452284 CAGGCACTGGCCCAAGATCTAGG - Intergenic
1029160679 7:98549327-98549349 GAGGCACCTGCCCTTCATCTTGG - Intergenic
1029269593 7:99369176-99369198 CAGGGCCCTGCCCCTGAGCGTGG - Intronic
1029479908 7:100806099-100806121 CAGGCACCCGCCCATCATGCTGG + Intronic
1031732001 7:125311894-125311916 CAGGCACTGGCCCAAGATCTAGG + Intergenic
1032000884 7:128264762-128264784 TGGGCACCTGCCCATGAGCCAGG - Intergenic
1032382455 7:131499064-131499086 CAGGACCCTGGCCATGGTCGAGG - Intergenic
1032494047 7:132347715-132347737 AAGGCAGGTGCCCATGATCACGG + Intronic
1033759015 7:144420852-144420874 CAGGCACTGGCCCAAGATCTAGG - Intergenic
1034042955 7:147898660-147898682 CAGGCACCTGCCACTGAGCCTGG + Intronic
1034579747 7:152032198-152032220 CAGGCACTGGCCCAAGATCTAGG - Intronic
1038430564 8:27496321-27496343 CAGGCACTGGCCCAAGATCTAGG - Intronic
1038453983 8:27659454-27659476 CCGGAACCTCTCCATGATCGTGG + Exonic
1039276218 8:35936059-35936081 CAGGCACTGGCCCAAGATCTAGG + Intergenic
1039787724 8:40848493-40848515 CAGGCAGCTGTACATGATTGAGG + Intronic
1040548350 8:48419671-48419693 CAGGCTCCGGCCCAAGGTCGAGG + Intergenic
1040649181 8:49430397-49430419 CAGGCACTGGCCCAAGATCGAGG + Intergenic
1040667656 8:49652942-49652964 CAGGCACTGGCCCAAGATCTAGG - Intergenic
1040953625 8:52958720-52958742 CAGGCACTGGCCCAAGATCTAGG + Intergenic
1042772129 8:72392019-72392041 CAGGCACTGGCCCAAGATCTAGG + Intergenic
1042919828 8:73910072-73910094 CAGGCACTGGCCCAAGATCTAGG + Intergenic
1044456409 8:92396818-92396840 CAGGCACTGGCCCAAGATCTAGG - Intergenic
1049207532 8:141370462-141370484 CAGGCACCTGCCATTGAGCTGGG + Intergenic
1049290084 8:141797255-141797277 CTGGGACCTGCCCATGGGCGAGG + Intergenic
1052057558 9:23921802-23921824 CAGGCACTAGCCCAAGATCTAGG - Intergenic
1056392562 9:86153210-86153232 CAGGCACTGGCCCAAGATCTAGG - Intergenic
1057587036 9:96337837-96337859 CAGGCACCTGCCCCTGCGCCTGG - Intronic
1059426874 9:114226830-114226852 CAGGCACCTGCCTTTGGTCTGGG + Intronic
1060048522 9:120359796-120359818 CAGGAACCTGCCCCAGATCGTGG - Intergenic
1060597218 9:124855835-124855857 CAGGCACCAGCCCGGGGTCGGGG - Intronic
1061620958 9:131810975-131810997 CAGGCACCTGCTCCTGTTAGGGG + Intergenic
1061920164 9:133778331-133778353 CAGCAACCTTCGCATGATCGTGG - Intronic
1061920746 9:133781030-133781052 CAGGTACCACCCCATGATCCAGG - Intronic
1188097745 X:26044187-26044209 CAGGCACTGGCCCAAGATCTAGG + Intergenic
1188136730 X:26501539-26501561 CAGGCACTGGCCCAAGATCTAGG + Intergenic
1189214283 X:39310068-39310090 CATGCACGTGCACAGGATCGAGG - Intergenic
1195439788 X:104886824-104886846 CAGGCACTGGCCCAGGATCTAGG + Intronic
1196127139 X:112112725-112112747 CAGGCACTGGCCCAAGATCTAGG - Intergenic
1196631840 X:117950322-117950344 CAGGCACCTGCCACTGCGCGCGG - Intronic
1197513623 X:127399084-127399106 CAGGCACTGGCCCAAGATCTAGG + Intergenic
1198251188 X:134880608-134880630 CAGGCATCTGCCTTTGATCCAGG + Intergenic
1199601819 X:149545543-149545565 CAGGCCACTGCCCATGAGCTTGG + Intronic
1199832186 X:151558146-151558168 CAGGCACTGGCCCAAGATCTAGG - Intergenic
1201286890 Y:12387042-12387064 GAGGCATCTGCCCATGCTCCAGG + Intergenic
1201311854 Y:12604651-12604673 CAGGCACTGGCCCAAGATCTAGG - Intergenic
1201429895 Y:13893003-13893025 CAGGCACTGGCCCAAGATCTAGG + Intergenic
1201455320 Y:14162301-14162323 CAGGCACTGGCCCAAGATCTAGG + Intergenic
1201472985 Y:14353859-14353881 CAGGCACTGGCCCAAGATCTAGG - Intergenic
1201729391 Y:17188564-17188586 CAGGCACTGGCCCAAGATCTAGG - Intergenic
1201743802 Y:17349875-17349897 CAGGCACTGGCCCAAGATCTAGG - Intergenic
1202192405 Y:22258831-22258853 CAGGCACTGGCCCAAGATCTAGG - Intergenic
1202243080 Y:22790221-22790243 CAGGCACTGGCCCAAGATCTAGG + Intergenic
1202258081 Y:22941375-22941397 CAGGCACTGGCCCAAGATCTAGG + Intergenic
1202271829 Y:23080858-23080880 CAGGCACTGGCCCAAGATCTTGG - Intergenic
1202294197 Y:23339824-23339846 CAGGCACTGGCCCAAGATCTTGG + Intergenic
1202396067 Y:24423971-24423993 CAGGCACTGGCCCAAGATCTAGG + Intergenic
1202411071 Y:24575133-24575155 CAGGCACTGGCCCAAGATCTAGG + Intergenic
1202424826 Y:24714602-24714624 CAGGCACTGGCCCAAGATCTTGG - Intergenic
1202445963 Y:24955483-24955505 CAGGCACTGGCCCAAGATCTTGG + Intergenic
1202459710 Y:25094939-25094961 CAGGCACTGGCCCAAGATCTAGG - Intergenic