ID: 1019524701

View in Genome Browser
Species Human (GRCh38)
Location 7:1475723-1475745
Sequence CTGGAGAGTCGTGGTGTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 124}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019524701_1019524705 11 Left 1019524701 7:1475723-1475745 CCCACAACACCACGACTCTCCAG 0: 1
1: 0
2: 1
3: 12
4: 124
Right 1019524705 7:1475757-1475779 AGAGCACCCGCAAGCTCCCTCGG 0: 1
1: 0
2: 1
3: 13
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019524701 Original CRISPR CTGGAGAGTCGTGGTGTTGT GGG (reversed) Intronic
900183674 1:1323322-1323344 CTGGAGGGACATGGTGTTGGTGG - Intronic
900440304 1:2651700-2651722 TTGGAGAGGGGTGGTGCTGTAGG - Intronic
902607527 1:17576885-17576907 CTGGAGAGTCACCGTGCTGTGGG + Intronic
904333061 1:29778002-29778024 CTGAAGAGTAGTGGTGGTGATGG - Intergenic
906539677 1:46575669-46575691 CTGGATATTGGAGGTGTTGTGGG + Intronic
909110127 1:71464806-71464828 CTGCAGCGTCTTGGTGTTGAAGG + Intronic
911173571 1:94796083-94796105 CTGGAGAGTGGTGGGGTGGTGGG - Intergenic
911382937 1:97138544-97138566 CTGGTGAGCAGTTGTGTTGTGGG + Intronic
916506344 1:165431330-165431352 CTGAAGAGTCTTGGTTTTCTTGG - Intronic
919894984 1:202004066-202004088 CTGGAGTGCCGTGGTGCTATTGG + Intronic
920498652 1:206472741-206472763 CTGGAGATTTGTGGTGGTGTGGG + Intronic
1063065500 10:2604230-2604252 CTGGAAAGTCGGGGTGATGAAGG + Intergenic
1063351676 10:5362519-5362541 CTGAAGGGTCTTGGTGTTGGTGG - Intergenic
1063688249 10:8258838-8258860 CTAGAGAGTCATGGGATTGTTGG - Intergenic
1063961162 10:11306410-11306432 ATGGAGAGTCTGGGTGTTGGTGG + Intronic
1064631874 10:17323443-17323465 CTGGAGTGTAGTGGTGCTCTGGG + Intronic
1064950873 10:20848722-20848744 CTGGCGAGTGGTGGTGGTGTTGG - Intronic
1068571627 10:58636127-58636149 CTGTAGAATTGTGATGTTGTGGG + Intronic
1069716462 10:70524211-70524233 CTGCAGAGTCGAGGGGTTGGGGG + Intronic
1069738836 10:70674693-70674715 CTGGAGTGTCGTGGTAGTGTGGG - Exonic
1072022507 10:91416852-91416874 CTGGGGAGTGGTGGGGTGGTGGG - Intronic
1072462147 10:95629538-95629560 CTGGAGAGTTGTGGAGTAGTAGG - Intronic
1076738430 10:132468814-132468836 CTGGACAGTGGTGGGGGTGTTGG + Intergenic
1077039314 11:511680-511702 CTGGAGATCCGTGCTGATGTGGG + Intergenic
1077675802 11:4192152-4192174 CTGCAGAGGCTTGGTGGTGTGGG + Intergenic
1079401950 11:20112848-20112870 TTGGAAAGACGTGGTTTTGTTGG + Intronic
1080550941 11:33373838-33373860 CTGGACAATTGTGGTGTTGATGG - Intergenic
1083713840 11:64564629-64564651 GTGGACAGTGGTGGTGCTGTTGG - Intronic
1084871373 11:72100720-72100742 AAGGAGAGTTGTGGAGTTGTGGG - Intronic
1089541018 11:119188992-119189014 CTGGAGTCACCTGGTGTTGTGGG - Exonic
1090475251 11:127014309-127014331 CTGGAGAGTCTTGCTCTTTTGGG + Intergenic
1092709995 12:11325928-11325950 CAGCAAAGTCTTGGTGTTGTAGG + Intergenic
1092718283 12:11414655-11414677 CAGAAAAGTCTTGGTGTTGTAGG + Intronic
1092781826 12:11994683-11994705 CTGGAGTGCAGTGGTGCTGTCGG - Intergenic
1099016107 12:77346224-77346246 CTGGAGTGTCCTGGTGTCCTGGG + Intergenic
1099153616 12:79146499-79146521 CTGTGGTGTGGTGGTGTTGTAGG - Intronic
1099205721 12:79723968-79723990 CTGGAGAGAGGTGGTGGTGGGGG - Intergenic
1101884229 12:108648025-108648047 CTGGAGAGTGCTGCTGTTGCCGG - Intronic
1106103599 13:26715165-26715187 CTGGAGATGGGTGGTGTTGATGG - Intergenic
1107428533 13:40317682-40317704 CTGTTGATTCGTGGAGTTGTGGG - Intergenic
1108530272 13:51321606-51321628 GAGGAGAGTCCTGGTGTTTTTGG + Intergenic
1113722006 13:112565249-112565271 CTTGCGAGTTATGGTGTTGTAGG - Intronic
1118525081 14:66631097-66631119 CTGGAGTGCAGTGGTGCTGTCGG + Intronic
1119160087 14:72445238-72445260 CTGGAGTGTAGTGGTGCAGTCGG + Intronic
1122145697 14:99687744-99687766 CTGGAGAGGTGTGGGGTGGTGGG + Intronic
1122699050 14:103574789-103574811 CTGGAGAGGTGGGGTCTTGTGGG + Intronic
1123626943 15:22233777-22233799 CTGGAGTGTAGTGGTGTGATCGG - Intergenic
1124941758 15:34224959-34224981 CTGGAAATTGGTGGTGCTGTGGG - Intergenic
1126576313 15:50200366-50200388 CTGGAGTGTAGTGGTGTTCAAGG - Intronic
1126600995 15:50427388-50427410 CTGAAGAGTGGTGGTGGTATTGG + Intronic
1131558373 15:93418515-93418537 CTGGGGAGGGGTGGTGATGTTGG + Intergenic
1131583857 15:93672566-93672588 CTGGAGATTCCTGGAGTTGAAGG + Intergenic
1131610980 15:93963525-93963547 GTGGAGGCTCCTGGTGTTGTAGG - Intergenic
1136093011 16:27934156-27934178 CTGGAGGGTAGTAGTGTTGGCGG - Intronic
1136641560 16:31569453-31569475 CTGGAGGGTGGTGGTGATGATGG + Intergenic
1139407654 16:66731796-66731818 CTGGAGAATCATAGTGTTGCTGG - Intronic
1140793942 16:78417869-78417891 CTGAAAAGTCATGGTGTGGTTGG - Intronic
1141977035 16:87523626-87523648 CTGGAGTGTAGTGGTGTGATCGG + Intergenic
1142342670 16:89534096-89534118 CTGGAGACACGTGGTGGTGGCGG - Intronic
1143380985 17:6496282-6496304 CTGGAGAGGGGTGGTGTGGGAGG - Intronic
1146566430 17:33916965-33916987 CTGGTGAGTGGTGGTGTGGGTGG + Intronic
1149459816 17:56819362-56819384 ATGGAGAGTGGTGGTGGTGGGGG - Intronic
1149469667 17:56905831-56905853 CTGGAGAGTGGGGGTGGTGAAGG + Intronic
1149562044 17:57615005-57615027 CAGGAGTGTGGTGGTGGTGTAGG + Intronic
1150491046 17:65574576-65574598 CTGGAGGGTAGTGGTGATGGGGG - Intronic
1155474875 18:26227226-26227248 CTGGATTGTCGTGGTGTTGGGGG - Exonic
1155494343 18:26428140-26428162 CTGGAGAGGCATGGTGGTGATGG - Intergenic
1156233459 18:35178440-35178462 ATGGAGAGGCTTGGTGTTGTGGG - Intergenic
1156378235 18:36533488-36533510 ATGGTGAGTTGTGGTGCTGTAGG + Intronic
1156952442 18:42919114-42919136 TTGGAGAGTCGTGATGGTTTTGG - Intronic
1157185784 18:45539117-45539139 CTGGAGAGTCGAGGTCCTCTGGG + Intronic
1160702745 19:516154-516176 CCAGAGGGTCCTGGTGTTGTGGG + Intronic
1160986258 19:1840319-1840341 CTGGAGAGTCGGTGTGCTGCAGG - Intronic
1167528802 19:50002034-50002056 CTGGGGAGCCCTGGTGTTATGGG - Intronic
927537819 2:23877807-23877829 CTGGAGTGCAGTGGTGCTGTTGG - Intronic
929678990 2:43969359-43969381 CTGGAGTGCAGTGGTGATGTCGG - Intronic
931704965 2:64939666-64939688 GGGGAGAGTAGTGGTATTGTAGG - Intergenic
932601987 2:73133846-73133868 CTGGAGGATCGTGGTATTCTTGG + Intronic
934483693 2:94680118-94680140 CTGGAGTGTCGTGGCGATCTTGG + Intergenic
937668791 2:124517170-124517192 ATGGAGTGTTGTGGTGTTGGTGG + Intronic
937668797 2:124517192-124517214 GTGGAGGGTTGTGGTGTTGGTGG + Intronic
941155801 2:161976463-161976485 ATGGAGAGTTGTGGTTTAGTGGG + Intronic
942527898 2:176875137-176875159 GTGGTGGGTGGTGGTGTTGTGGG + Intergenic
948768011 2:240233401-240233423 CTGGAGAGGGGAGGTGCTGTGGG - Intergenic
1173759314 20:45545932-45545954 CTGGGGAGTGGTGGGGGTGTAGG - Intronic
1174883150 20:54303001-54303023 CTGGAGTGTAGTGGTGATCTTGG + Intergenic
1177368927 21:20176258-20176280 CTGGAGTGTAGTGGTGGTCTCGG - Intergenic
1177603643 21:23350684-23350706 CTGGAGTGTAGTGGTGATCTCGG + Intergenic
1178330675 21:31688064-31688086 CTGGAATGTGGTGGTGATGTTGG - Intronic
1179950052 21:44704246-44704268 CTGGAGAGTGGTGGGGGGGTGGG - Intronic
1181318762 22:21988711-21988733 CGGGAGAGTGGTGGTCATGTGGG - Intergenic
1181491842 22:23265044-23265066 ATGGAGAATCGTGTTGTTGGGGG + Intronic
1183789939 22:40058691-40058713 CTGGAGAGGCGTGATGCTGTTGG + Intronic
1184236636 22:43186736-43186758 CTGGAGCGGCGTGGAGTTGGGGG - Intronic
1184283750 22:43454353-43454375 CTGGAGTGCAGTGGTGTTCTTGG + Intronic
1184294277 22:43514115-43514137 CTGGAGTGCAGTGGTGTTCTCGG - Intergenic
1184697770 22:46149766-46149788 CTGGAGAGGGGTGGGGTTGTGGG + Intergenic
960720033 3:120616636-120616658 AGGGAGAGTCAAGGTGTTGTAGG - Intergenic
961027735 3:123574750-123574772 CTGGAGGGGCGTGGTATTTTGGG - Intronic
974479338 4:62423302-62423324 CAGGAGAGTTGGGGTGTTGGGGG + Intergenic
978036644 4:104003093-104003115 CTGGAGAGGTGTTGTGTAGTGGG - Intergenic
978585674 4:110273509-110273531 CTGCAGATACGTGGTGTGGTTGG + Intergenic
979409537 4:120359538-120359560 CTGGTCAGTGGTGGAGTTGTGGG + Intergenic
981107664 4:140899526-140899548 CTGGAGATTGGTGGTGGTGGTGG + Intronic
994908104 5:105867180-105867202 CTGGAGAGTTGTGACGTTTTGGG + Intergenic
996690941 5:126339103-126339125 CTTGACAATCGTGGTGTTGTGGG - Intergenic
996843818 5:127877809-127877831 CAGGGGAGTGGTGGTGTTCTAGG - Intergenic
996871154 5:128194614-128194636 TTGGAGAGTGGTGGTGGTGGTGG - Intergenic
1000991647 5:167917346-167917368 CTGGAGTCTCGGGGGGTTGTAGG + Intronic
1001964102 5:175898293-175898315 CTGGAGAGGGGTGGTGGTGATGG - Intergenic
1002853498 6:1017497-1017519 CTTGAAAGTCATTGTGTTGTGGG + Intergenic
1005013086 6:21354540-21354562 CTGGAGATTTGTGGTTTTGCAGG - Intergenic
1007125511 6:39422723-39422745 CTGGAGAGGCGTGGAGATGCAGG - Intronic
1009298148 6:61980761-61980783 CTGCAGAGTTGTGGTGGTTTGGG - Intronic
1010239041 6:73599845-73599867 CTGGAGTGCAGTGGTGATGTTGG + Intronic
1010762983 6:79746056-79746078 CTGGAGTGCAGTGGTGATGTTGG + Intergenic
1014775934 6:125510001-125510023 TTTGAGAGTTGTTGTGTTGTAGG + Intergenic
1017755566 6:157526385-157526407 GAAGAGGGTCGTGGTGTTGTGGG - Intronic
1019524701 7:1475723-1475745 CTGGAGAGTCGTGGTGTTGTGGG - Intronic
1022491961 7:30827551-30827573 CTGTAGAATCCTGGTGGTGTTGG + Intronic
1026108165 7:67437361-67437383 CTGGAGACTGGTTGTGTTGTAGG - Intergenic
1027448688 7:78304214-78304236 CTGGAAAGCTGTGGAGTTGTAGG - Intronic
1029541167 7:101182904-101182926 CAGTAGAGTGGTGGTGATGTGGG + Intergenic
1035573410 8:688489-688511 CAGGAGGGCCGTGGCGTTGTAGG - Intronic
1037021244 8:13974168-13974190 GTGGACAGTGGTTGTGTTGTTGG + Intergenic
1042370955 8:67990296-67990318 CTTAAGAGTCCTGGTGTTGCTGG + Intronic
1045393338 8:101736580-101736602 CTGGAAAGTGGTGTTTTTGTCGG - Intronic
1045883771 8:107071603-107071625 GTGGAGAGTGGTGCTGTTGTTGG + Intergenic
1049384773 8:142337680-142337702 CAGGAGTGCCGTGGTGGTGTGGG - Intronic
1057100122 9:92351427-92351449 CTGGAGTGTAGTGGTGCTCTCGG - Intronic
1061674638 9:132208843-132208865 TTGGAGAGACGGGCTGTTGTGGG - Intronic
1187943032 X:24400192-24400214 CTGCAGTGTCGTGGTATAGTGGG + Intergenic
1192735853 X:73849205-73849227 CTGGAGAATCCTGCTGTTCTTGG - Intergenic
1194193188 X:90861494-90861516 CTGTAGAGGCTTGGTGTTCTGGG - Intergenic
1199694534 X:150334605-150334627 CAGGAGAGTCCTGGTGTTGTAGG - Intergenic
1200539802 Y:4443944-4443966 CTGTAGAGGCTTGGTGTTCTGGG - Intergenic
1201114111 Y:10822496-10822518 GTGGAGAGGAGTGGAGTTGTAGG - Intergenic
1201189717 Y:11436301-11436323 GAGGCGAGTCGTGGTGTTGCAGG - Intergenic