ID: 1019525431

View in Genome Browser
Species Human (GRCh38)
Location 7:1478477-1478499
Sequence GGGGCTCCTGCGCCTGGCCG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 492
Summary {0: 1, 1: 1, 2: 2, 3: 39, 4: 449}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019525431_1019525433 -10 Left 1019525431 7:1478477-1478499 CCTCGGCCAGGCGCAGGAGCCCC 0: 1
1: 1
2: 2
3: 39
4: 449
Right 1019525433 7:1478490-1478512 CAGGAGCCCCCCTCGCACTGTGG 0: 1
1: 0
2: 1
3: 19
4: 154
1019525431_1019525434 -9 Left 1019525431 7:1478477-1478499 CCTCGGCCAGGCGCAGGAGCCCC 0: 1
1: 1
2: 2
3: 39
4: 449
Right 1019525434 7:1478491-1478513 AGGAGCCCCCCTCGCACTGTGGG 0: 1
1: 0
2: 1
3: 8
4: 94
1019525431_1019525435 -6 Left 1019525431 7:1478477-1478499 CCTCGGCCAGGCGCAGGAGCCCC 0: 1
1: 1
2: 2
3: 39
4: 449
Right 1019525435 7:1478494-1478516 AGCCCCCCTCGCACTGTGGGAGG 0: 1
1: 0
2: 0
3: 12
4: 155
1019525431_1019525441 14 Left 1019525431 7:1478477-1478499 CCTCGGCCAGGCGCAGGAGCCCC 0: 1
1: 1
2: 2
3: 39
4: 449
Right 1019525441 7:1478514-1478536 AGGTCTGTGTGAGTGCCCTGTGG 0: 1
1: 0
2: 3
3: 32
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019525431 Original CRISPR GGGGCTCCTGCGCCTGGCCG AGG (reversed) Exonic
900190048 1:1349398-1349420 CGGGGTCCTGAGCGTGGCCGCGG + Intergenic
900341919 1:2193665-2193687 GGGGCAGCTGCGCAGGGCCGCGG + Exonic
900397889 1:2460701-2460723 GGGGCTCCTGGTCCTGGGGGTGG + Intronic
900429879 1:2596460-2596482 GGTGCCCCTGAGCCTGGGCGGGG + Intronic
900625390 1:3606201-3606223 GAGGCTGCTGGTCCTGGCCGGGG - Intronic
900929333 1:5726409-5726431 GGGGCTCCTGAGCCTGGCCGTGG + Intergenic
900929424 1:5726875-5726897 GGGGCTCCTGAGCCTGGCCATGG - Intergenic
900994501 1:6113139-6113161 TGGGCCACTGCACCTGGCCGAGG - Intronic
901596157 1:10386829-10386851 TGGGCCACTGCGCCTGGCCCGGG + Intergenic
901635009 1:10666460-10666482 GGGGCTGCAGAGGCTGGCCGAGG - Intronic
901685370 1:10940728-10940750 GTCGCTCCTGTGCCTGGCTGGGG - Intergenic
901858448 1:12059027-12059049 GGTGCACCTGCGGCTGGGCGCGG + Intergenic
902176580 1:14655110-14655132 GGTGCTGCTGCTCCTGGCCTAGG + Intronic
902586738 1:17444011-17444033 TGAGCCACTGCGCCTGGCCGCGG - Intergenic
902931811 1:19736674-19736696 AGGGCTGCTGCTCCTGGCCTTGG - Intronic
903060297 1:20664394-20664416 GGGGCTCCTGCCCAGGGCGGAGG + Exonic
903550285 1:24153261-24153283 CTGGCTCCTGCCCCTGGCAGTGG + Intergenic
903568226 1:24285004-24285026 GGGGCTCCTGGGCTGGGCCAAGG - Intergenic
903822069 1:26111014-26111036 GAGGCGCCTGCACCTGGCTGCGG - Intergenic
903861511 1:26367552-26367574 GCTGCACCTGCGCCTGGCAGAGG - Intronic
904280323 1:29414189-29414211 GGAGCTCCTGCTTCTGCCCGGGG - Intergenic
904688443 1:32276371-32276393 GGGGCTTCTGGGTCTGGCAGGGG - Exonic
905078279 1:35293598-35293620 TGAGCTCCTGCGCCCGGCTGTGG + Intronic
905643986 1:39611781-39611803 GTGGATCCTGTGCCTGGCCGTGG + Intergenic
905875546 1:41429879-41429901 GGGGCTCCTGACCCTGACAGAGG - Intergenic
906052772 1:42888361-42888383 GGAGCTCCAGGGCCTGGCTGTGG - Intergenic
910623700 1:89284310-89284332 GGGGACCCTGGGCCTGGCCCAGG - Intergenic
912279488 1:108297968-108297990 GGGGACCCTGGGCCTGGCCCAGG + Intergenic
912288738 1:108396389-108396411 GGGGACCCTGGGCCTGGCCCAGG - Intronic
912630019 1:111238861-111238883 GGGGCCCCTGCCTCTGGCCCTGG + Exonic
913598031 1:120396319-120396341 GAGTCTCCTGCCCCTGGCCAGGG + Intergenic
914089298 1:144483001-144483023 GAGTCTCCTGCCCCTGGCCAGGG - Intergenic
914309313 1:146451214-146451236 GAGTCTCCTGCCCCTGGCCAGGG + Intergenic
914512367 1:148345343-148345365 GAGTCTCCTGCCCCTGGCCAGGG - Intergenic
914592798 1:149121923-149121945 GAGTCTCCTGCCCCTGGCCAGGG - Intergenic
914803109 1:150974585-150974607 GGGGCTCGGGCGCCGGGCGGGGG + Intronic
915214139 1:154328894-154328916 GCGGCTCCTGCACCTCCCCGGGG + Intronic
915271846 1:154759176-154759198 GGGGCCCCCGCGCCAGGCTGGGG - Intronic
915327167 1:155086483-155086505 GGAACACCTGCCCCTGGCCGTGG + Exonic
915545071 1:156592375-156592397 GGGGCTCCTGGACATGGACGTGG - Exonic
916695676 1:167233419-167233441 TGAGCTCCTGTGCCTGGCCTAGG + Intronic
917106052 1:171493031-171493053 TGAGCCACTGCGCCTGGCCGGGG + Intronic
918044841 1:180935550-180935572 GGGGCGCCTTCCCCTGGGCGGGG - Exonic
918275779 1:182952908-182952930 GCGGCTCCAGCGCCTGCCCGCGG - Exonic
919690861 1:200527287-200527309 GGGGCTTCTGGGCCTGACTGTGG + Intergenic
919956415 1:202421351-202421373 TGAGCTACTGCGCCTGGCCATGG - Intronic
920678359 1:208054385-208054407 TGGGCACCTGCACCTGGCCCTGG + Intronic
920927983 1:210360591-210360613 TGAGCTACCGCGCCTGGCCGAGG + Intronic
921029726 1:211326825-211326847 GCGGCTGCTGCTCCTGGCTGCGG - Exonic
922406217 1:225316199-225316221 GGGACTCCTGAGCTTGGTCGGGG - Intronic
922417865 1:225438222-225438244 GGGGCTCCTCCTCCTGGCCAAGG + Intergenic
922661171 1:227431740-227431762 GGGGCTCCGGGGCCTCGCTGGGG + Intergenic
923461177 1:234210963-234210985 GGGGACCCTGGGCCTGGCCCAGG - Intronic
924056025 1:240124947-240124969 TGAGCCACTGCGCCTGGCCGTGG + Intronic
924510894 1:244728624-244728646 GGGGCGCCGGCTCCTGGCCTCGG + Intergenic
1063154022 10:3361873-3361895 GGAGCCCCTGGGCCTGGCCCAGG - Intergenic
1065131852 10:22630051-22630073 TGAGCTACTGCGCCTGGCCTTGG - Intronic
1067053190 10:43036986-43037008 GGGCCCCCTGCTCCTGGCCAAGG - Intergenic
1067249655 10:44575866-44575888 GGGCCTCCTGGGCCTGCCCTGGG - Intergenic
1067344431 10:45427551-45427573 GGGGGTCCTGCGCGCGGGCGCGG + Intronic
1067381113 10:45774267-45774289 GGGGCTCCTGAGCCTTTCCTTGG + Intronic
1067753131 10:48984971-48984993 GGGGCTGCTGCTCCTGGCTGTGG + Intergenic
1067888810 10:50114896-50114918 GGGGCTCCTGAGCCTTTCCTTGG + Intronic
1069706646 10:70462871-70462893 GGGGCTCCTGGGTGTGGCCACGG - Intergenic
1069962808 10:72088274-72088296 GCCGCTGCTGCTCCTGGCCGCGG - Exonic
1070301955 10:75210468-75210490 GGGGCGTCGGCGCGTGGCCGGGG - Intronic
1070723276 10:78771402-78771424 TGAGCCACTGCGCCTGGCCGTGG + Intergenic
1070793398 10:79203054-79203076 GGGGCTCAGGCCCCTGGCCTAGG + Intronic
1074703624 10:116112815-116112837 GGGGCTCCAGCGCTTGGCTGGGG + Intronic
1074828106 10:117229052-117229074 GTCGTTCCTGCCCCTGGCCGGGG - Intergenic
1074828561 10:117232181-117232203 GTCGTTCCTGCCCCTGGCCGGGG - Intergenic
1075014902 10:118903494-118903516 GGGGCTCCTTCCCTTGGCCCAGG - Intergenic
1075645483 10:124093375-124093397 GGGGCTCCGGCGCCCCTCCGCGG - Intronic
1075722222 10:124593783-124593805 GGGGCTCCCTCGGCTGACCGAGG + Intronic
1075953822 10:126505389-126505411 GGGGTTCCTGGGCTTGGCGGAGG - Intronic
1076631389 10:131854238-131854260 CTGGCGCCTCCGCCTGGCCGTGG - Intergenic
1077021966 11:420910-420932 GGGGCTCCCGGGGCTGGGCGGGG + Intronic
1077089356 11:771443-771465 GGGGCTCCTGAGACAGGCCCAGG + Intronic
1077140696 11:1023680-1023702 GGGGTTCCTGGCCCTGGCCCTGG + Intronic
1077182285 11:1222216-1222238 GGGGGTCCTGGACCTGCCCGGGG - Intergenic
1077326269 11:1965390-1965412 AGGGCAGCTGGGCCTGGCCGTGG + Intronic
1077483241 11:2826392-2826414 GCGGCTGCTGGGCCTGGCCGCGG - Intronic
1078010804 11:7571777-7571799 GGGGCTCCTGGGCCGGGCTCAGG + Intronic
1078308965 11:10219389-10219411 GGGGGCCCTGGGCCTGGCCCAGG + Intronic
1078404595 11:11058876-11058898 TGAGCTACTGCGCCTGGCCTAGG + Intergenic
1078509965 11:11977659-11977681 GGAGCCACTGAGCCTGGCCGGGG + Intronic
1078645342 11:13136921-13136943 TGAGCCACTGCGCCTGGCCGAGG - Intergenic
1081774069 11:45665748-45665770 CGGGCTCCGGAGCCTGGCTGCGG - Intergenic
1083724881 11:64622902-64622924 GGGTCACCTGCGCCTGGTGGGGG - Exonic
1083886515 11:65576002-65576024 GGGGCTCCGGCGCGGGGCGGGGG - Intergenic
1085266575 11:75241082-75241104 GGGGCTGCTGCTCGTGGCGGCGG + Exonic
1087754678 11:102042575-102042597 TGAGCCACTGCGCCTGGCCGTGG - Intergenic
1087793608 11:102432760-102432782 GGGGCCCCTGGGCCTGGCCCAGG - Intronic
1090504603 11:127297948-127297970 GGGGTTCCTGGGCTTGGCCCAGG - Intergenic
1091154777 11:133362413-133362435 TGGGCTCCTGGTCCTGTCCGAGG - Intronic
1202809250 11_KI270721v1_random:20569-20591 AGGGCAGCTGGGCCTGGCCGTGG + Intergenic
1091796225 12:3298880-3298902 GGGACTCCTGCGGCTGGGCTTGG - Intergenic
1091825457 12:3509191-3509213 GGGGCTCCTGAGCCCGGGTGAGG - Intronic
1092252694 12:6909609-6909631 GGGGCTCCTGGGCCGGGTAGGGG + Intronic
1095097385 12:38155819-38155841 GCAGCCCCTGCGCCTGGCCCGGG + Intergenic
1095873033 12:47051182-47051204 TGGGGTCCTGGGCCTGGCCCTGG + Intergenic
1095942683 12:47737112-47737134 GGGGCCCCTGCCCCAGGCCAAGG + Exonic
1096156098 12:49342339-49342361 GGAGCTCCTGGGCCCGGCCCGGG + Intergenic
1096402154 12:51316220-51316242 GTGGCTCATGCGCCCGGCCTTGG + Intronic
1096796003 12:54077921-54077943 GGGCCTCCTGTGCCTTGGCGGGG - Intergenic
1099008244 12:77260460-77260482 GGGGACCCTGGGCCTGGCCTGGG + Intergenic
1100830868 12:98515791-98515813 GGCGCGCTTGCTCCTGGCCGGGG - Exonic
1102050928 12:109861464-109861486 TGAGCTACTGCGCCTGGCCTCGG - Intronic
1102472614 12:113168091-113168113 AGGGCTGCGGGGCCTGGCCGGGG - Intronic
1103209995 12:119158634-119158656 GGGGCACCTGCCCCTGTCCCAGG - Exonic
1103595483 12:122022350-122022372 GGGTCACCTGCGCCAGGCTGGGG + Intronic
1103804305 12:123560427-123560449 GGAGCTACCGCGCCTGGCCAGGG + Intergenic
1103932440 12:124457837-124457859 CGGGCTGGTGGGCCTGGCCGAGG - Intronic
1104842136 12:131830340-131830362 GTGGCTCCCCAGCCTGGCCGGGG + Intronic
1105015804 12:132786297-132786319 GGGGCTGGTGACCCTGGCCGGGG + Intronic
1105031441 12:132887256-132887278 ACGGCTCCTGCGTCTGGGCGCGG - Exonic
1105830552 13:24160525-24160547 AGAGCCACTGCGCCTGGCCGGGG + Intronic
1105943284 13:25170141-25170163 GAGCCTCCTGCGCTTGACCGAGG + Exonic
1108724351 13:53163809-53163831 GGGGACCCTGGGCCTGGCCCAGG + Intergenic
1111133255 13:84003081-84003103 GGAGCCACTGCGCCTGGCCTTGG + Intergenic
1111716685 13:91887319-91887341 GGGGCACCTGCACCTGGCCCAGG + Intronic
1111883206 13:93985149-93985171 TGAGCCCCTGCGCCTGGCCCTGG - Intronic
1113467525 13:110522762-110522784 GGGTCTGCTGCTGCTGGCCGTGG - Intergenic
1113868795 13:113545797-113545819 GGGGCATCAGCGACTGGCCGGGG + Intronic
1114323069 14:21563135-21563157 TGAGCCCCTGCGCCTGGCCTGGG + Intergenic
1114480094 14:23027858-23027880 TGAGCCACTGCGCCTGGCCGGGG - Intronic
1118755474 14:68840127-68840149 TGAGCTGCTGCGCCTGGCCAAGG - Intergenic
1118989364 14:70783998-70784020 TGAGCCACTGCGCCTGGCCGTGG - Intronic
1119660059 14:76444668-76444690 GGAGCCACTGCGCCTGGCCCAGG + Intronic
1121007899 14:90501994-90502016 GGGGGTCCTGCGGGTGGCCAGGG - Intergenic
1122202075 14:100128647-100128669 TGGGCTCCTCCGGCTGGCAGTGG - Exonic
1122686025 14:103506988-103507010 TGAGCCCCTGCGCCTGGCCTTGG - Intergenic
1122709500 14:103645254-103645276 GGAGCCACTGCGCCTGGCCTGGG + Intronic
1122770960 14:104097451-104097473 GGGGCTCCTGGGCTGGGCCTGGG + Intronic
1122773888 14:104108764-104108786 GTGTCCCCTGCGCCTGGCTGAGG + Intronic
1122873176 14:104650719-104650741 GGGGCTCCTCTGGCTGGCTGGGG + Intergenic
1123011519 14:105352063-105352085 GGTGCTGCTGCACCTGGCCGTGG + Intronic
1123110187 14:105863615-105863637 GGGGCTCCTTCGGCTGGTCTGGG - Intergenic
1124184628 15:27513162-27513184 TGAGCTACTGCGCCTGTCCGTGG - Intronic
1125535866 15:40441060-40441082 GGGGCGGGCGCGCCTGGCCGGGG - Intronic
1126467676 15:48975876-48975898 GGGGGCGCTGCGCCTGCCCGCGG - Intergenic
1128750872 15:70148169-70148191 AGAGCCACTGCGCCTGGCCGAGG - Intergenic
1129109801 15:73330700-73330722 CGGGCTCCTGCGCCTTCCCCTGG - Intronic
1129653876 15:77510111-77510133 GGGGCTGCTGCTCCTGCCCTTGG + Intergenic
1129986979 15:79926530-79926552 TGGGCTCCTGAGTCTGGCGGGGG + Intergenic
1131030087 15:89179196-89179218 GGGGCTTCTGCCCCTGGCCTGGG - Intronic
1131264844 15:90909891-90909913 GGGGCACCTTCGGCTGGGCGCGG - Intronic
1132225007 15:100133602-100133624 GGGGCTGCTGCTCCTGGCCAGGG - Intronic
1132465979 16:77685-77707 GAGGCCCCCGCCCCTGGCCGGGG - Intronic
1132500279 16:281903-281925 GGGGCCCCTGCCACCGGCCGTGG + Exonic
1132749164 16:1449403-1449425 GGGGCTGCTGGGCCTGGGCAGGG - Intronic
1132792365 16:1698872-1698894 TGGGCTCCTGCTCCTTGGCGGGG - Exonic
1132799734 16:1746095-1746117 GTGGCTCCTGTGCCTGTCCCAGG - Intronic
1132850693 16:2023700-2023722 GGGGCTCCGGGGTGTGGCCGTGG - Intergenic
1133076348 16:3283686-3283708 GGGGCTCCTCGGCCTGGACTGGG + Exonic
1134041931 16:11075718-11075740 TGAGCCCCTGCGCCTGGCCTTGG + Intronic
1134122656 16:11596187-11596209 TGGGCTGCTTCTCCTGGCCGTGG - Intronic
1134627823 16:15735421-15735443 GGGCCTCCAGCTCCTCGCCGAGG + Exonic
1135307266 16:21377784-21377806 TGAGCTACTGTGCCTGGCCGTGG + Intergenic
1135776078 16:25258177-25258199 GGGACTCCTGTGTCTGGCGGAGG + Intergenic
1136304014 16:29356926-29356948 TGAGCTACTGTGCCTGGCCGTGG + Intergenic
1136541047 16:30927848-30927870 GGGGCCCTTGCGCCTGGGCGGGG - Exonic
1137254885 16:46766699-46766721 TGAGCCACTGCGCCTGGCCGAGG - Intronic
1137951887 16:52791760-52791782 GGGGGCCCTGGGCCTGGCCCAGG - Intergenic
1138517363 16:57543627-57543649 GGAGCCCCTGCCCCTGGCCTGGG - Intronic
1138601140 16:58055309-58055331 TGAGCCACTGCGCCTGGCCGAGG - Intergenic
1139908468 16:70381958-70381980 GGGGCTCCTGCATCTCCCCGGGG - Intronic
1141441721 16:84033569-84033591 TGGGCTCCTGGGGCTGGCTGAGG - Intronic
1141663131 16:85452516-85452538 GGGGCTTCTGGGCCCCGCCGGGG - Intergenic
1141796513 16:86278814-86278836 GGGGCACCTGCCCCTGCCCCAGG - Intergenic
1141796533 16:86278878-86278900 GGGGCACCTGCCCCTGCCCCAGG - Intergenic
1141796553 16:86278942-86278964 GGGGCACCTGCCCCTGCCCCAGG - Intergenic
1142099743 16:88264884-88264906 GGGGCTCCTGAGGGTGACCGTGG + Intergenic
1142215518 16:88827865-88827887 GGAGCTCCAGGGCCTGGCAGCGG - Intronic
1142229438 16:88892931-88892953 GCGGCCCCTACGCCTGGCCTGGG + Intronic
1142282789 16:89157167-89157189 GAGGCTCCTGCTCCTGACCCTGG - Intergenic
1142477948 17:200749-200771 GGGACTCCTGGGCCAGGCCCTGG + Intergenic
1143081755 17:4386832-4386854 TGAGCTGCTGCGCCTGCCCGTGG - Intergenic
1144620929 17:16818109-16818131 GGGCCTCCTGGGCCTGAGCGGGG + Intergenic
1144781208 17:17809575-17809597 GGGGCTCCTGGGGGTGGGCGGGG - Intronic
1144786763 17:17836495-17836517 AGGGCTCCTGGGCCGGGCCGGGG - Intronic
1144891433 17:18496468-18496490 GAGGGTCCTGGGCCTGGCCCAGG + Intergenic
1144960030 17:19039659-19039681 GGGGCTCCTGGGGTTGGCAGGGG + Intronic
1144975130 17:19134865-19134887 GGGGCTCCTGGGGTTGGCAGGGG - Intronic
1145019074 17:19415947-19415969 CGGGCTCATGGGCCTGGCAGGGG + Exonic
1145140788 17:20447849-20447871 GAGGGTCCTGGGCCTGGCCCAGG - Intergenic
1145248471 17:21284806-21284828 GCTGCTCCTCCGCCTGGCCTGGG + Exonic
1146058717 17:29593582-29593604 GGGGCCGCGGCGCCCGGCCGGGG - Exonic
1146477250 17:33172950-33172972 GCTGCTCCTGTGCCTGGCTGTGG + Intronic
1147159461 17:38561926-38561948 GGGCCGTCTGAGCCTGGCCGCGG - Exonic
1147192816 17:38747570-38747592 GGGGCGCCGGCGCCGGGACGGGG + Intronic
1147633882 17:41950657-41950679 TGAGCCACTGCGCCTGGCCGAGG + Intronic
1147683830 17:42275637-42275659 TGGGCTCGTGCGTGTGGCCGTGG - Intronic
1147720389 17:42536302-42536324 GGGGGTCCTTCTCCTGGCCGGGG + Exonic
1148736710 17:49869265-49869287 TGGGCTCCTGGGCCTGGAGGAGG + Intergenic
1149314028 17:55421961-55421983 GGGGCTCCTGCGCCCCGCCCCGG + Exonic
1151344434 17:73492965-73492987 GGTCCTCCTGCGCCCGGCCTTGG - Intronic
1151698666 17:75731116-75731138 GGGCCACCTGGGCCTGGCCCTGG + Intronic
1151763816 17:76122053-76122075 GGGGCTCCTGGGCCTGCTGGGGG - Intergenic
1151848281 17:76673390-76673412 GGGTCACCTGCGCCTGGTGGAGG - Exonic
1152068795 17:78125219-78125241 GGAGCTCCAGAGCCTGGCAGTGG - Exonic
1152095618 17:78270023-78270045 GGGGCCCCTCCACCTGGCAGAGG - Intergenic
1152123550 17:78433175-78433197 GGGGCTCCTGGGCCTGTGCCAGG + Intronic
1152214667 17:79025141-79025163 GAGGCTCCAGCCCCAGGCCGGGG - Intronic
1152245606 17:79183214-79183236 GGCGCACGTGCGCCGGGCCGGGG + Intronic
1152302574 17:79503877-79503899 GGGGCTCCTGGACCAGGACGGGG + Intronic
1152466059 17:80466739-80466761 GGGTCACCTGCACCTGGCTGGGG + Intergenic
1152541017 17:80975578-80975600 TGAACTCCTGCGCCTGGCCTGGG - Intergenic
1152544113 17:80992171-80992193 GGGTCTCCTGCGCGGCGCCGTGG + Intronic
1152551188 17:81031167-81031189 GGAGCAGCTGGGCCTGGCCGGGG - Intergenic
1152571218 17:81122072-81122094 GGGGCCCCTGAGTCTGGCGGAGG - Exonic
1152677247 17:81648006-81648028 CGGGGTCCTGCGCCTGGATGCGG + Exonic
1152782298 17:82231730-82231752 GGGGCTCCTGGCCCTGGCCCTGG + Intronic
1152821528 17:82440056-82440078 GGGGCTCAGGCGCCCGGCCCTGG + Intronic
1153514408 18:5891103-5891125 GGAGCCCCCGAGCCTGGCCGAGG - Exonic
1154228112 18:12526989-12527011 TGAGCTACTGCGCCTGGCCACGG + Intronic
1155196857 18:23483898-23483920 TGAGCCACTGCGCCTGGCCGAGG - Intronic
1155461547 18:26090191-26090213 GGGGCGCGTGCGCCCGGCGGCGG - Intronic
1156463782 18:37336137-37336159 GAGGCTCCTGGGGCTGGCTGTGG - Intronic
1157040086 18:44028296-44028318 TGGGGTCCTGGGCCTGGCCCAGG + Intergenic
1157460692 18:47890090-47890112 GGGGCTCCTGCTCCAGGACCTGG - Intronic
1157609968 18:48950079-48950101 GGAGCTGCTGCTCCAGGCCGTGG - Exonic
1158405274 18:57154645-57154667 GCCGCTCCGGGGCCTGGCCGAGG + Intergenic
1159433320 18:68384154-68384176 GGGGACCCTGGGCCTGGCCTAGG - Intergenic
1159511298 18:69400945-69400967 GGGGCTCCCGCAGCTGGCGGAGG + Intergenic
1159939741 18:74397737-74397759 GTGGCTCCTGAGGCTGGTCGAGG + Intergenic
1160135611 18:76268739-76268761 TGAGCCACTGCGCCTGGCCGAGG + Intergenic
1160540454 18:79617616-79617638 GGGGAGCCTGGGCCTGGCCTGGG - Intergenic
1160908819 19:1465503-1465525 GGTGCTCCAGCGCCTGCGCGAGG - Exonic
1160917850 19:1506269-1506291 GGGTCTCCTGGGCCTGGTGGTGG + Exonic
1160935423 19:1592433-1592455 GGCGCCCCTGCCCCGGGCCGCGG - Intronic
1160961868 19:1725723-1725745 GGGGCGCATGCGCGGGGCCGCGG + Intergenic
1161422329 19:4182655-4182677 GAGGCGCATGCGCCTTGCCGTGG - Intergenic
1161821121 19:6531754-6531776 GGGTCTCCTCCTCCTGGCCTGGG - Intronic
1162525017 19:11201860-11201882 GGGGATCCTGGGCCTGGCGGGGG - Intronic
1163570480 19:18078915-18078937 TGGGCCCCTGTGCCTGGCCATGG - Intronic
1164449476 19:28348042-28348064 TGGGCCACTGCGCCTGGCCGAGG + Intergenic
1164627015 19:29736440-29736462 GGGACTACTGCGCCTGGCCACGG - Intergenic
1164659220 19:29948949-29948971 GGGGCGCCTCCGCCCGGCCGCGG - Intronic
1164747828 19:30628984-30629006 TGGGCCACTGCGCCTGGCCCAGG + Intronic
1165358610 19:35319452-35319474 TGGGCTCTTGCGACTGGCCGGGG + Intronic
1165390552 19:35536294-35536316 TGAGCCACTGCGCCTGGCCGGGG - Intronic
1165788193 19:38474916-38474938 GGGGCTGCTGCTGCTGGGCGGGG + Intronic
1165941444 19:39416593-39416615 GGGGCTCCTGCCCCTCACCTCGG - Exonic
1166112263 19:40629741-40629763 GGGGCCCCTGGGCCAGGCCCGGG - Intronic
1166126329 19:40717259-40717281 GGGGCCCCTGCGCCGGGCCCAGG - Exonic
1166556140 19:43700925-43700947 GGAGCCACTGCGCCTGGCGGGGG - Intergenic
1166733737 19:45072425-45072447 CCCGCTCCTGGGCCTGGCCGAGG - Exonic
1168214059 19:54912311-54912333 TGAGCTACTGCGCCTGGCCAAGG - Intronic
1168692767 19:58386728-58386750 GGTGCTCCTGGGCCGGGCGGTGG + Intronic
925070899 2:965644-965666 GGGGCTGCTGCTGCTGGCGGGGG + Intronic
925718819 2:6808965-6808987 GGGGCTGCTGTGCTTGGCTGGGG + Intergenic
926300704 2:11600010-11600032 GGGGCTCCTGGGCCAGGTCGTGG + Intronic
930762211 2:55049758-55049780 GGAGCCCCTGCGCTTGGGCGCGG + Exonic
932740539 2:74287535-74287557 GGGGCTCATGGGCCTGGATGTGG - Intronic
932767720 2:74481988-74482010 AGGGCTGCTGGGCCTGGTCGGGG - Exonic
934949202 2:98564772-98564794 GGGGCTCCCGATCCTGGCCCGGG - Intronic
935257725 2:101327338-101327360 TGAGCCACTGCGCCTGGCCGAGG - Intergenic
936078625 2:109417543-109417565 CGGGGTCCTGTGCCTGGCTGAGG - Intronic
936283926 2:111166287-111166309 GGGCCTCCCGTGCCTGGCCCAGG - Exonic
937133724 2:119534254-119534276 TGAGCTACTGCACCTGGCCGAGG + Intergenic
937262111 2:120593214-120593236 TGAGCCCCCGCGCCTGGCCGAGG + Intergenic
939355488 2:141096302-141096324 TGAGCCACTGCGCCTGGCCGAGG - Intronic
943624085 2:190180286-190180308 GGGGCCCCGCAGCCTGGCCGCGG - Intronic
944272252 2:197796577-197796599 GGGGGCCCTGGGCCTGGCCCAGG + Intergenic
944349090 2:198705775-198705797 TGGGCTACTGCACCTGGCCAAGG - Intergenic
944864204 2:203845136-203845158 TGAGCTACTGCTCCTGGCCGGGG + Intergenic
945119661 2:206444062-206444084 GGGGCTGCTGCGCCCAGCGGTGG + Exonic
946322007 2:218959852-218959874 GGGCCTCCGGCCCTTGGCCGAGG - Exonic
946409358 2:219508653-219508675 GGAGCACCTGCCCCTGGACGGGG + Intergenic
946739530 2:222788133-222788155 TGGGCCACTGCGCCCGGCCGTGG + Intergenic
948009094 2:234636523-234636545 GGGGTCCCTGGGCCTGGCCCAGG - Intergenic
948046878 2:234951970-234951992 GGTGGTCCCGCGCCTGGGCGGGG - Intronic
948364452 2:237445792-237445814 GGGGCTCCTGCACCTGAGCATGG - Intergenic
948438162 2:237967535-237967557 GGGCGTCCAGCGCCTGGCCAAGG + Intronic
1169422468 20:5471410-5471432 GGTGCTTCTGCGCCAGGCCCTGG + Intergenic
1169427004 20:5504369-5504391 GGTGCTCCTGCACCGGGCCTTGG - Intergenic
1170756955 20:19213034-19213056 GGGGCTCCCGGGGCTGGGCGCGG + Intronic
1171207140 20:23289862-23289884 GGGTCTCCTGGCCCTGGCAGGGG + Intergenic
1171366610 20:24629178-24629200 TGGGCTCCTGGGCCTGCCCTTGG - Intronic
1172118227 20:32583949-32583971 GCTGCTCCTGCGCCAGGCTGCGG + Intronic
1173196002 20:40913349-40913371 GCGGCTACTGTGCCTGGCCCTGG - Intergenic
1173461339 20:43245618-43245640 GGGGCTTCTGTGCTTGGCCCTGG - Intergenic
1173627128 20:44481259-44481281 TGAGCTGCTGCGCCTGGCAGGGG - Intronic
1174506840 20:51022768-51022790 GGGGCGGCTGCACGTGGCCGTGG - Intronic
1175751355 20:61500096-61500118 GGGCCTCCTCCTCCTGGCTGAGG - Intronic
1175776631 20:61658064-61658086 GGAGCTCCTGTGCCTGGCTGGGG - Intronic
1175777889 20:61664360-61664382 GGGACTCCTGGGCCTGGGAGTGG + Intronic
1175820404 20:61906070-61906092 GCGGCCCCTGCGTCTGGCCTGGG - Intronic
1176154409 20:63611015-63611037 GGTGCTGCTGGGCCTCGCCGGGG - Intronic
1176178441 20:63739211-63739233 GGGGCGCCCGGGCCTAGCCGAGG + Intronic
1176242682 20:64082431-64082453 AGGGCTCCACCCCCTGGCCGGGG + Intronic
1176298817 21:5088819-5088841 GGGGCTCCTCCGCCTGGAGGCGG + Intergenic
1176309513 21:5142238-5142260 GGGGCTCCAGTACGTGGCCGAGG - Intronic
1176414861 21:6468278-6468300 GGGGCTCCTTCGCCAGGTCCCGG + Intergenic
1179690361 21:43076600-43076622 GGGGCTCCTTCGCCAGGTCCCGG + Intronic
1179847547 21:44119795-44119817 GGGGCTCCAGTACGTGGCCGAGG + Intronic
1179858209 21:44173130-44173152 GGGGCTCCTCCGCCTGGAGGCGG - Intergenic
1180144695 21:45912696-45912718 GGAGCTCCTGTGCCTGGGTGGGG + Intronic
1180228345 21:46411779-46411801 GGGGCTGCTGCTCCAGGGCGCGG - Exonic
1180257672 21:46643841-46643863 GGTGCTTCTGCCCCTGGCTGAGG - Intronic
1180570947 22:16718173-16718195 GCAGCTCCTGCGCCTGGAGGAGG - Intergenic
1180593956 22:16961812-16961834 GGGGCTCCTGGGACAGGCAGGGG - Intergenic
1180912031 22:19457527-19457549 TGGGCCACCGCGCCTGGCCGAGG - Intronic
1180926703 22:19560067-19560089 GGGGCTGCTGGGGCTGGCCCAGG + Intergenic
1180975340 22:19844976-19844998 GGGGCTGGTGCCCCTGGCCTCGG + Intronic
1181052905 22:20246149-20246171 GTGGCTCCTGAGCCAGGCCTGGG - Intronic
1181618014 22:24068224-24068246 GAGGCTCCAGCTCCTGGCAGAGG + Intronic
1181660724 22:24346286-24346308 TGAGCCACTGCGCCTGGCCGTGG + Intronic
1181745968 22:24955062-24955084 TGAGCCACTGCGCCTGGCCGGGG + Intronic
1181845821 22:25707952-25707974 TGAGCCACTGCGCCTGGCCGGGG - Intronic
1183103416 22:35598078-35598100 GGGGCTCTTCCGCCAGGCTGCGG - Intergenic
1183220665 22:36510581-36510603 GGGGCTGCTGCGCCTGAGGGAGG - Intergenic
1183935826 22:41261601-41261623 GGGGCTCCTGCCCATGACCAGGG - Intronic
1184033702 22:41909005-41909027 GGGCTTCCTGCACCTGGCTGTGG - Intergenic
1184164758 22:42720731-42720753 GGGGATCCTGCGGCTCGCAGTGG - Intronic
1184177172 22:42794987-42795009 GGGGGTCCTGCGGCTGGGCCTGG - Intergenic
1184442563 22:44526777-44526799 GGGGCTCCTGCCGCTGTCTGAGG - Intergenic
1184551911 22:45209156-45209178 GGGCCTCCTGCACCTAGCAGGGG - Intronic
1184769364 22:46588690-46588712 GGGGCTCCTGGATCAGGCCGGGG - Intronic
1184973999 22:48047913-48047935 CTGGCTCCTGTGCCTGGCCCTGG + Intergenic
1185327413 22:50233776-50233798 TGGGGTCCTGGGCATGGCCGGGG + Intronic
949916470 3:8968397-8968419 GGGGCTCCTGAGCCAGGCTCCGG - Intergenic
950043249 3:9933528-9933550 GGGACTCCCGCGCCGGGACGCGG + Exonic
950122466 3:10490778-10490800 GGGCCTCCTGCAACTGGCAGGGG + Intronic
950803314 3:15573735-15573757 GGTGCTGATGCGCCTGGCCCAGG + Intronic
952178743 3:30895072-30895094 GGGGCTCCTCCGGCTGGATGAGG - Intergenic
952504563 3:33996054-33996076 GGGGTCCCTGGGCCTGGCCCAGG + Intergenic
953979441 3:47406321-47406343 GGCACTCCTGAGCCTGGCCCTGG - Exonic
954022168 3:47751798-47751820 TGAGCTACTGCGCCTGGCCAAGG - Intronic
954374636 3:50187903-50187925 GGGGGGCCTGCGCCTGGGGGTGG - Exonic
954671974 3:52296061-52296083 GAGGCTAGTGTGCCTGGCCGAGG + Intergenic
957662808 3:83183559-83183581 GGGGACCCTGGGCCTGGCCCAGG - Intergenic
958742621 3:98093470-98093492 TGAGCTGCTGCGCCTGGCCTAGG + Intergenic
959512836 3:107233594-107233616 GGGGACCCTGGGCCTGGCCCAGG - Intergenic
960473177 3:118093123-118093145 GGGGGCCCTGTGCCTGGCAGTGG - Intergenic
962307286 3:134299992-134300014 GGGGCATCTGCTCCTGGCAGTGG + Intergenic
962818136 3:139020683-139020705 GGCGCTCCTGGGCCTAGCAGCGG + Exonic
962820630 3:139044642-139044664 GGCGCTCCTGGGCCTGGCAGGGG + Exonic
963391190 3:144665819-144665841 GGGGTCCCTGGGCCTGGCCCAGG + Intergenic
965127508 3:164649523-164649545 GGGGACCCTGGGCCTGGCCCAGG - Intergenic
966972779 3:185060839-185060861 GGGGGCCCTGGGCCTGGCCCAGG - Intergenic
967155022 3:186684125-186684147 GGGGAACCTGGGCCTGGCCCAGG + Intergenic
967173768 3:186844426-186844448 TGAGCCACTGCGCCTGGCCGAGG + Intronic
968353105 3:198079316-198079338 TGAGCTACTGCGCCTGGCCTGGG + Intergenic
968511528 4:997785-997807 GGGGTTCCTGGGCCTGGGGGCGG + Intronic
968816734 4:2825238-2825260 GGGGCGCCTGGGCCTGACCCGGG + Intronic
968914587 4:3491892-3491914 ACGGCTCCTGCACTTGGCCGTGG - Intronic
969357871 4:6641265-6641287 CGGGCACCCGCGCCAGGCCGAGG + Intronic
969379158 4:6782932-6782954 GGGGCTCCGGGGCCAGCCCGAGG + Intronic
969499017 4:7541963-7541985 GGGGGTCCTGCACATGGCTGGGG - Intronic
969869572 4:10096206-10096228 GGGGCTCCTTGGCCTGCCCTGGG - Intronic
972162569 4:36244479-36244501 GGTGCTCCCGCGCCTCGCCTCGG + Exonic
975564605 4:75740568-75740590 TGAGCTACTGCGCCTGGCCTAGG + Intronic
976431351 4:84966323-84966345 GGGGCTCCCGGGCCCCGCCGCGG - Exonic
978643943 4:110906442-110906464 GGGGCTGCTGCTCTTGGCTGGGG + Intergenic
980974624 4:139598852-139598874 GGCACTCCTGCCCCTGTCCGTGG + Intronic
984876404 4:184371689-184371711 TGAGCCCCTGCGCCTGGCCAGGG - Intergenic
985225296 4:187753496-187753518 TGAGCCACTGCGCCTGGCCGGGG + Intergenic
985718396 5:1475752-1475774 CGGACTCCTGGGCCTGGGCGGGG - Intronic
985718417 5:1475820-1475842 CGGACTCCTGGGCCTGGGCGGGG - Intronic
985718438 5:1475889-1475911 CGGACTCCTGGGCCTGGGCGGGG - Intronic
985761636 5:1752019-1752041 GGGGCCCCTACCCCAGGCCGTGG + Intergenic
985778813 5:1858950-1858972 GGGGCTGCTGATCCTGGCCAAGG + Intergenic
985791467 5:1930766-1930788 GGGGCCACTGCGCCGGGCCTTGG - Intergenic
986557635 5:9027275-9027297 GGGGGCCCTGGGCCTGGCCTGGG - Intergenic
986640640 5:9868519-9868541 GGGGGCCCTGGGCCTGGCCCAGG + Intergenic
988164207 5:27561965-27561987 TGGGCCACTGCGCCTGGCCTAGG - Intergenic
991674180 5:69075476-69075498 GGAGCTCCTGCCGCTGGCAGGGG + Intergenic
992269731 5:75052858-75052880 GGGCCCCCTGCGCCTCGCAGCGG + Intergenic
993531182 5:89027230-89027252 GGGGGACCTGGGCCTGGCCAGGG + Intergenic
994072844 5:95620892-95620914 CGGCCGCCCGCGCCTGGCCGGGG + Exonic
996033570 5:118733607-118733629 GGGGACCCTGGGCCTGGCCCAGG - Intergenic
999748316 5:154608651-154608673 GGGGCTGCTGACCCTGGCCCAGG - Intergenic
1000659465 5:163920211-163920233 GGGGGTCCTGGACCTGGCCCAGG - Intergenic
1001819447 5:174698574-174698596 GGGGCTTCTGCTGGTGGCCGGGG + Intergenic
1002058109 5:176610168-176610190 GCGGCTACTGCGCATGCCCGGGG - Intergenic
1002188381 5:177466581-177466603 GGGGCTCTGGCCTCTGGCCGTGG - Intronic
1002559393 5:180071471-180071493 GCGGCGCCAGCACCTGGCCGCGG + Exonic
1003868185 6:10381982-10382004 GGGGCTCCAGCGCGTCCCCGGGG - Intergenic
1004076366 6:12347521-12347543 TGGGCCACTGCGCCTGGCCCAGG - Intergenic
1004228953 6:13814103-13814125 CGCGCTGCTGCGCCCGGCCGGGG + Exonic
1004423879 6:15494729-15494751 GGGGGTCCTGGGCCAGGCCTAGG + Intronic
1006084720 6:31587672-31587694 CGGGCTCCTGCTTCTGGCAGTGG + Exonic
1006860873 6:37170768-37170790 GGGGCTCCTTCTCCTTGCCTAGG - Exonic
1007701921 6:43770793-43770815 CGGGCTCCGGCCCCTGCCCGCGG - Exonic
1007750552 6:44068312-44068334 CGGGCTCCTGCACCAGGCCCTGG - Intergenic
1007889266 6:45271337-45271359 GGGGACCCTGGGCCTGGCCCAGG - Intronic
1008092645 6:47308990-47309012 GGGGCTCCCACGGCCGGCCGAGG - Intronic
1009620004 6:66063578-66063600 GGGGGCCCTGGGCCTGGCCCTGG - Intergenic
1014019641 6:116572283-116572305 GGGGCTCCTGCTCCAAGCCAAGG + Intronic
1015315124 6:131808282-131808304 CGGGCGCCGGGGCCTGGCCGCGG - Intronic
1015724612 6:136287744-136287766 TGAGCCCCTGCGCCTGGCCTCGG - Intronic
1015799202 6:137044228-137044250 GGGGCCCCTCCGCGCGGCCGCGG + Intronic
1016987859 6:149908680-149908702 GGGGACCCTGGGCCTGGCCCAGG - Intergenic
1017701489 6:157077429-157077451 GAGGCTCCGGAGCCTGGCAGAGG - Intronic
1018799037 6:167208738-167208760 GGGGGTCCTGAGCCTGACCATGG - Intergenic
1018813599 6:167315323-167315345 GGGGGTCCTGAGCCTGACCATGG + Exonic
1018828436 6:167424127-167424149 GGGGCTCCTGGGGAGGGCCGTGG + Intergenic
1018906460 6:168078884-168078906 GGAGCAACTGCGGCTGGCCGTGG - Exonic
1019113820 6:169740537-169740559 GGGCCTTCTGCTCCTGGCCCTGG - Intronic
1019219715 6:170463965-170463987 GGGTCTCATGAGCCTGGCTGAGG - Intergenic
1019381632 7:727158-727180 GCAGCTGCTGGGCCTGGCCGTGG + Exonic
1019473296 7:1232588-1232610 GGGGCCCCTGCCCCGGGCCCAGG + Intergenic
1019525431 7:1478477-1478499 GGGGCTCCTGCGCCTGGCCGAGG - Exonic
1019689646 7:2403557-2403579 GGGGCTCCTGCGCCGGGGGCGGG + Exonic
1020611333 7:10401474-10401496 GGGGCCCATGGGCCTGGCCCAGG + Intergenic
1021151104 7:17151573-17151595 AAGTCACCTGCGCCTGGCCGGGG + Intergenic
1021692894 7:23247725-23247747 GGGTCTCCTGGGCCGGGGCGCGG - Intronic
1022088142 7:27088416-27088438 GGGGCACCAGCGCCTGCCCCCGG - Intergenic
1022324474 7:29318495-29318517 GGGGCTGCTGAGCCTGTCCTGGG + Intronic
1023983077 7:45080843-45080865 GGGGCTCCAGGGCCTCGCAGGGG - Intronic
1024963987 7:55005422-55005444 CGGCCTTCTGCGCCTGGCAGGGG - Intergenic
1027428426 7:78085049-78085071 TGGGCTCCTGTGCCTTGCTGAGG - Intronic
1029527597 7:101104501-101104523 GGGGCTCCTGCACTTGGCCAGGG + Intergenic
1029708225 7:102286548-102286570 GGGAGTCCCGCGCCTGGCCTGGG + Intronic
1029745450 7:102513488-102513510 GGGGCTCCTGGGGCTGGGAGAGG + Intronic
1029763389 7:102612467-102612489 GGGGCTCCTGGGGCTGGGAGAGG + Intronic
1030049032 7:105522001-105522023 GGGGCTCCTCGGCCTGGCCCTGG - Intronic
1030169879 7:106590267-106590289 GGGGCCACTGCCCCTGGCCTAGG + Intergenic
1030611729 7:111697366-111697388 GGAGCTGCTGTGCCTGGCTGAGG + Intergenic
1030884776 7:114923072-114923094 GGGGCCGCAGCGCGTGGCCGAGG + Exonic
1031088122 7:117323313-117323335 GGGGGTGCTGCGCCTGGCGGGGG + Intergenic
1031545771 7:123050016-123050038 GGGGTCCCTGGGCCTGGCCCAGG + Intergenic
1032037419 7:128531023-128531045 GGGCGTCCTGCGACTGCCCGAGG - Intergenic
1032855885 7:135833089-135833111 GGGGTTACAGCGCCTGGCCTGGG + Intergenic
1033426538 7:141249653-141249675 GGGGCTCATGTGCCTGGCCAAGG + Intronic
1036128099 8:6082247-6082269 GGGGCTCTTGGGCCTGGCTGGGG + Intergenic
1036255568 8:7203859-7203881 TGAGCTGCTGTGCCTGGCCGAGG - Intergenic
1036361918 8:8083642-8083664 TGAGCTGCTGTGCCTGGCCGAGG + Intergenic
1037979146 8:23238208-23238230 GGGGACCCTGGGCCTGGCCCAGG + Intergenic
1039969143 8:42306790-42306812 GGAGCCACTGAGCCTGGCCGAGG + Intronic
1040459721 8:47635571-47635593 GGTGCCACTGCGCCTGGCCAGGG - Intronic
1040691976 8:49949854-49949876 TGGGCCACTGCGCCTGGCCAAGG - Intronic
1040864335 8:52032934-52032956 GGAGCTCCTGAGCCTGGGCAAGG - Intergenic
1042532663 8:69832073-69832095 GCGGCCCCTGTGGCTGGCCGTGG - Exonic
1043875418 8:85480564-85480586 TGAGCCACTGCGCCTGGCCGGGG + Intronic
1045307985 8:100975176-100975198 TGTGCTACTGCGCCTGGCCATGG + Intergenic
1047520701 8:125593459-125593481 GGGGCTGCTGAGCCTGGACGTGG + Intergenic
1049473768 8:142787651-142787673 TGGGCTCCTGCGCGAGGCGGTGG - Intergenic
1049475377 8:142794720-142794742 TGGGCTGCAGCGCCTGGCCAAGG - Intergenic
1049682369 8:143925260-143925282 GCGGCGCCTGCGGCAGGCCGAGG - Exonic
1049686839 8:143942480-143942502 GGGGCGCCTTTGCCTCGCCGAGG - Intronic
1049710491 8:144060886-144060908 GGGTCTCCGGCGCCGGGCCTGGG + Intronic
1049710782 8:144062427-144062449 GGGGCTCCTGCATGTGGGCGTGG - Intronic
1049789901 8:144467758-144467780 GGGTCGACTGCGCCTGGGCGTGG + Exonic
1051710722 9:19927956-19927978 GGGTCTGCTGCACCTGGCTGGGG + Intergenic
1053381184 9:37650816-37650838 GGGGCTCCTCCCCCGGGGCGGGG + Intronic
1053739205 9:41123420-41123442 GGGTCCCCGGCGGCTGGCCGAGG - Intergenic
1053920464 9:42984980-42985002 CGGGCTCCGGCGACTGCCCGGGG + Intergenic
1054689147 9:68307902-68307924 GGGTCCCCGGCGGCTGGCCGAGG + Intergenic
1055049060 9:71961276-71961298 TGAGCCACTGCGCCTGGCCGTGG - Intronic
1055113729 9:72585431-72585453 GGAGCCACTGCGCCTGGCCTGGG + Intronic
1055931351 9:81562805-81562827 GGGGCTCCTGTGCCTGGCCCTGG + Intergenic
1056362183 9:85869660-85869682 TGAGCCACTGCGCCTGGCCGAGG + Intergenic
1056458988 9:86791203-86791225 GGGGATCCTGTGCCTGACTGTGG + Intergenic
1056975026 9:91245215-91245237 GGGGCTCCTGGGGTGGGCCGTGG - Intronic
1061042756 9:128149473-128149495 GTGGCTGCTGGGCCTGGCAGGGG - Exonic
1061130926 9:128707257-128707279 GGACCTCCTGCGCCTGGCCTTGG + Exonic
1061296238 9:129678382-129678404 GGGGCCCCTGTGCCTGGCCAGGG - Intronic
1061481242 9:130898691-130898713 GGGACTCCTGAGCCAGGCCACGG - Intergenic
1061757741 9:132827105-132827127 GGCGCTGCTGTGCCTGGCTGGGG + Intronic
1061778399 9:132981687-132981709 GGGGCCCCTGGGCCTGACCTGGG + Intronic
1061972074 9:134050326-134050348 GGGGCACCTGAGCCCGGCCAGGG - Intronic
1062093449 9:134690550-134690572 GTGGCTCCTGAGGCTGGCAGGGG - Intronic
1062183183 9:135202189-135202211 GGGTCACCTGCACCTGCCCGAGG + Intergenic
1062271873 9:135713613-135713635 GAGCCTCCTGCCCCTGCCCGTGG + Intronic
1062461610 9:136664740-136664762 GCAGCTCCTGCCCCTGTCCGGGG + Exonic
1062542416 9:137047477-137047499 GGGGCTGCAGGGCCTGGCTGGGG + Intergenic
1062634902 9:137485683-137485705 GGGTCTCCAGGGCCTGGCCCAGG - Intronic
1062658960 9:137618571-137618593 GCGGCTCCCGCGCCAGGCCGCGG + Exonic
1203776059 EBV:73810-73832 GGGGCGCCTTCCCCTGGCCTCGG - Intergenic
1185457608 X:318656-318678 GGGGCTCCTGCGGCCGACAGCGG + Exonic
1186466311 X:9786569-9786591 GCGGCCCGAGCGCCTGGCCGAGG + Exonic
1187273789 X:17801470-17801492 TGGGCTCCTGCGGCTGGCTGGGG + Exonic
1189028865 X:37429071-37429093 GGGGACCCTGGGCCTGGCCCAGG + Intronic
1189298458 X:39935602-39935624 GGGGCTCGTGCGGCTGGTAGCGG + Intergenic
1190242594 X:48668952-48668974 TGAGCTGCTGCGCCCGGCCGAGG - Intergenic
1190402417 X:50050943-50050965 TGAGCCACTGCGCCTGGCCGTGG + Intronic
1192208285 X:69110345-69110367 GGGGCTCCTGCTCCCAGCCCTGG - Intergenic
1192270578 X:69575509-69575531 GGGGACCCTGGGCCTGGCCTAGG + Intergenic
1196284413 X:113863332-113863354 AGGGCTCCTGCGCTTTGCTGGGG + Intergenic
1197128225 X:122972797-122972819 GGGGGCCCTGGGCCTGGCCCAGG - Intergenic
1197301740 X:124789237-124789259 GGGGGTCCTGGACCTGGCCCAGG + Intronic
1198302411 X:135344894-135344916 GGGGCTCCTTTCCGTGGCCGGGG + Intronic
1199869749 X:151887940-151887962 GGGGCTCCCAGGCCTGGCCCAGG - Intergenic
1200146329 X:153928151-153928173 GGGTCCCATGGGCCTGGCCGGGG + Intronic
1201763436 Y:17560911-17560933 GCGGCCCCTGCGCCGGGCCGAGG - Intergenic
1201764098 Y:17563592-17563614 GCAGCCCCTGCGCCTGGCCCCGG - Intergenic
1201837455 Y:18342398-18342420 GCAGCCCCTGCGCCTGGCCCCGG + Intergenic
1201838117 Y:18345079-18345101 GCGGCCCCTGCGCCGGGCCGAGG + Intergenic
1202578180 Y:26349818-26349840 TGCGCTACTGCGCCTGGCCATGG + Intergenic