ID: 1019526059

View in Genome Browser
Species Human (GRCh38)
Location 7:1481034-1481056
Sequence CTGAAGTCCTTGGGAAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 222}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019526059_1019526064 6 Left 1019526059 7:1481034-1481056 CCAGCACTTCCCAAGGACTTCAG 0: 1
1: 0
2: 1
3: 17
4: 222
Right 1019526064 7:1481063-1481085 GGTGAGCTCAGTCAGCACTGAGG 0: 1
1: 0
2: 3
3: 19
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019526059 Original CRISPR CTGAAGTCCTTGGGAAGTGC TGG (reversed) Intronic
900122516 1:1054850-1054872 CCGTAGGCCTTGGGCAGTGCTGG - Exonic
900416596 1:2537980-2538002 CTGACGTCCTTGGGAGCTGCTGG + Intergenic
900543059 1:3213669-3213691 CTGGAATCCTGGGGAAATGCTGG - Intronic
901759583 1:11462003-11462025 CCGATGGCCTTGGGAAGAGCTGG + Intergenic
902292483 1:15444535-15444557 CTGAAGGCCTGGGGAGGGGCTGG + Intronic
902690876 1:18109550-18109572 CCGAAGTCCTTGGGGAGTGCTGG + Intronic
902816710 1:18920657-18920679 CTGAAGGCCTTGGAGAGGGCAGG - Intronic
908513472 1:64869311-64869333 CTGATGTCCTTGGGCAGTTCTGG + Exonic
913339812 1:117747449-117747471 CAGGGGTCCTTGGGGAGTGCTGG - Intergenic
915526160 1:156477462-156477484 CTGAAGTCAGTGGGAAGAACTGG + Intronic
915674947 1:157520852-157520874 CTGAAGTGCTTCTGAAGTGATGG - Intronic
917992876 1:180401296-180401318 CTAAAGTGCTTTGAAAGTGCAGG + Intronic
919142056 1:193584814-193584836 CTGAATCCCTTAGGAAGAGCAGG - Intergenic
919682716 1:200452472-200452494 CTTAAGTCCTTAGTAAGTGAGGG - Intergenic
919822039 1:201479555-201479577 CTCAAGTCCCTGGCAAGTGGTGG - Intergenic
923042275 1:230327743-230327765 CGGCAGTCCTTGGGCACTGCAGG - Intronic
924671624 1:246133010-246133032 CTGAAACCCTTGGGTACTGCTGG + Intronic
1063960865 10:11304530-11304552 CTGCAGTCCTGAGGCAGTGCGGG + Intronic
1065171201 10:23031621-23031643 CTGATGTCCTTGAGAAGTGATGG + Intronic
1067077212 10:43194970-43194992 CTGAAGACATTGGGAAAGGCTGG - Exonic
1067513160 10:46911874-46911896 CTTGAGTCATTGGGAAGTTCTGG - Intronic
1067649093 10:48139968-48139990 CTTGAGTCATTGGGAAGTTCTGG + Intergenic
1069775368 10:70924098-70924120 CTGACGTCCTTGGCAAGAGTGGG - Intergenic
1071567801 10:86680654-86680676 CTGTAGCCCTTAGGACGTGCTGG + Intronic
1073243027 10:102070559-102070581 CTGAAGTCCCTGGGAAGGTGAGG + Intergenic
1073623361 10:105072070-105072092 CTGAGATTCCTGGGAAGTGCTGG + Intronic
1075567320 10:123514063-123514085 CTGGAGTCCTGGGGAAGGGGAGG + Intergenic
1075742696 10:124705502-124705524 CTGAAGCCCATGGGAAGCCCAGG - Intronic
1075759688 10:124846550-124846572 CTGATGGCCTGGGGAAGTGGTGG - Intergenic
1076728257 10:132423879-132423901 CTGCAGTCCTAGGCAAGTGGAGG + Intergenic
1077236605 11:1484829-1484851 CTGAAGCCTGTGGGCAGTGCAGG - Intronic
1078170621 11:8926463-8926485 GGCAAGTCCTTGGGAAGTGGAGG - Intronic
1078443879 11:11389709-11389731 CTCAAAGCCTTGGGAATTGCTGG + Intronic
1079063071 11:17266575-17266597 GTGAAGTCCTTGAGAAGTGAGGG + Intronic
1082739814 11:56898357-56898379 CTGAGTCCCTTGGGAAATGCTGG - Intergenic
1083296844 11:61719621-61719643 CTGAAGGCCTTGGGAAGGTGGGG - Intronic
1083860363 11:65417146-65417168 AAGAAGTCCTTGGGAAGAGCTGG - Intergenic
1083969947 11:66068815-66068837 GACAAGTCCTTGGGAACTGCGGG - Exonic
1084532101 11:69733367-69733389 CTGACTCCCTTGGGAAGAGCTGG - Intergenic
1084649305 11:70479383-70479405 CTGGAGGCCTTGGGAAGGGGAGG + Intronic
1084658228 11:70531724-70531746 CTGAGCGCCTTGGGAAGTCCTGG + Intronic
1086700703 11:89897622-89897644 CTGAATTCCTCAGGAAGTGAAGG - Intergenic
1086705466 11:89946904-89946926 CTGAATTCCTCAGGAAGTGAAGG + Intergenic
1088225215 11:107612555-107612577 CTGAACCACTTGGGAAATGCTGG + Intronic
1088626159 11:111732118-111732140 ATGGAGAACTTGGGAAGTGCAGG - Intronic
1089595139 11:119573814-119573836 CTGCAGGCCCTGGGAAATGCAGG + Intergenic
1089617478 11:119703095-119703117 GTGCAGGCCCTGGGAAGTGCTGG - Intronic
1089781899 11:120879109-120879131 CTGAAGTCCTTGCTAATAGCGGG - Intronic
1090069900 11:123534933-123534955 CTGAGGGCCTTGGGAAGGGAGGG + Intronic
1096453053 12:51761229-51761251 TGGAAGTCATCGGGAAGTGCAGG + Intronic
1096534329 12:52261493-52261515 CTGGAGTCCTCAGGCAGTGCAGG + Intronic
1096904286 12:54919209-54919231 CTGAAGTGGTTGGGAAGAGGGGG + Intergenic
1099467600 12:83006098-83006120 CAGAAGTCCATGGTAAGTGTGGG + Intronic
1099854110 12:88142258-88142280 CTGAAGTCCCTGAGAAGAGGAGG + Intergenic
1099948843 12:89277272-89277294 ATGAAGTGCTTGTCAAGTGCAGG - Intergenic
1100899256 12:99219720-99219742 CTGAAGTCCCAGGGGTGTGCTGG + Intronic
1102442604 12:112975094-112975116 CGGAAGTCCTTTGGGAGTTCAGG + Intergenic
1103839450 12:123850695-123850717 CTGAAGGCCTTGGGGAGGGCAGG - Intronic
1105246227 13:18653002-18653024 CTGAATTCTTTGGGAAGGGCTGG + Intergenic
1106135237 13:26968623-26968645 CTGCAGTCCTTGGGGACTCCTGG - Intergenic
1106266244 13:28112832-28112854 CTGTAATCTTTGGGAAGTCCAGG + Intergenic
1106609439 13:31264307-31264329 CTGGAGTCACGGGGAAGTGCTGG - Intronic
1110694496 13:78472347-78472369 CAGACGTCTTTGGGAAGTGAGGG - Intergenic
1113990580 14:16024467-16024489 CTGAAATCCTTGGGATGCTCAGG + Intergenic
1116188980 14:41638171-41638193 CTGAAGACCTTGGGACCTCCAGG + Intronic
1116594915 14:46828863-46828885 GTGAAGTCCTAGGGATGTGCTGG - Intergenic
1117725375 14:58667971-58667993 CTGAAGTCCTTTAGAAATGTTGG + Intergenic
1119462096 14:74814781-74814803 TTGAAGACCTTGGGAAGAGTCGG + Intronic
1121063945 14:90943532-90943554 CTGAAGCCGTTAGGAAGTGATGG - Intronic
1121385131 14:93513815-93513837 TTTAAGTCCTTGGGAAGAGAAGG - Intronic
1126238155 15:46409737-46409759 CTGAAGACCTTGGGAAACACAGG - Intergenic
1126558590 15:50018566-50018588 CTGAGGTCATTCTGAAGTGCAGG - Intronic
1127027297 15:54821013-54821035 CTGAAGAACTAGGGAAGAGCTGG - Intergenic
1130648380 15:85748128-85748150 CTAAAATCCTTGGGAAGACCTGG - Intronic
1131450774 15:92537867-92537889 CTGCAGTCATGGGGAACTGCAGG + Intergenic
1132002900 15:98197663-98197685 GTGAACTCCTTGGTAAGTGTGGG - Intergenic
1132611033 16:816418-816440 CTGGTGCCCTTGGGAGGTGCAGG + Intergenic
1133256470 16:4519596-4519618 CTGTGGTGCTTGGGAAGTCCAGG - Intronic
1134040088 16:11061778-11061800 CTGATGTCACTGGGAAGTCCAGG + Intronic
1135182767 16:20290020-20290042 CTGGCCTCCTTGGGGAGTGCGGG - Intergenic
1135254509 16:20930262-20930284 CTGGAGTCCTGGGGAAGAGATGG - Intergenic
1136173125 16:28499995-28500017 CTGATGTCATTGGGAACCGCTGG - Intronic
1138114486 16:54349698-54349720 ATGAAGTCATAGGGAAGAGCTGG - Intergenic
1138364306 16:56461324-56461346 CTGAACTCCCATGGAAGTGCTGG + Intronic
1140210101 16:72962842-72962864 CTGTGGTCCCTGGGAGGTGCAGG + Intronic
1141226326 16:82119548-82119570 CTGCAGGCCTGGGGTAGTGCTGG + Intergenic
1144362447 17:14508231-14508253 CTGAAGCCCTTTGGAACTTCAGG + Intergenic
1144722193 17:17478955-17478977 CTGTAATCCTAGGGCAGTGCTGG + Intronic
1144829136 17:18121894-18121916 GTGACATCCTTGGGAGGTGCTGG - Exonic
1145114555 17:20197185-20197207 CTGAACTCCTTGGGAAAAACAGG - Intronic
1147254692 17:39174799-39174821 CTGCAGTACTGGGGAAGGGCTGG - Exonic
1148291434 17:46454331-46454353 CTGAAGTCCATAGTAGGTGCTGG + Intergenic
1148313622 17:46672033-46672055 CTGAAGTCCATAGTAGGTGCTGG + Intronic
1148487431 17:47999840-47999862 CAGAAGGCCTTGGGACCTGCAGG - Intergenic
1151827141 17:76529864-76529886 GTGGAGTCCTCGGGAACTGCTGG - Intronic
1151849528 17:76682191-76682213 CTGAAGCTCCTGGGGAGTGCTGG + Intronic
1153192617 18:2558991-2559013 CTGGAGCCCTTGGGTATTGCTGG + Intronic
1153336073 18:3926162-3926184 CTGAAGTAGTTGGGAAGACCTGG - Intronic
1154442691 18:14406664-14406686 CTGAATTCTTTGGGAAGGGCTGG - Intergenic
1159554634 18:69932584-69932606 CTGGTGTGCTTGGGAATTGCAGG - Intronic
1160143441 18:76346629-76346651 CTGGGGACCTTGGGCAGTGCAGG - Intergenic
1160672469 19:372746-372768 CAGAAGCCCCTGGGAACTGCAGG - Intronic
1160706921 19:534182-534204 CTGAAGTCTTGGGGAACCGCAGG + Intronic
1162669292 19:12241277-12241299 CTGCAGTCCTTGTGTATTGCTGG + Intronic
1164712533 19:30367663-30367685 CTTTAGCCCCTGGGAAGTGCTGG + Intronic
1165071740 19:33259777-33259799 CTGGAGTTCTTGGGAGGTGGAGG - Intergenic
1167869522 19:52356100-52356122 CTGAAGACCTTGAGATGTCCTGG - Intronic
1168588277 19:57612206-57612228 GTGAAGGCATTGAGAAGTGCTGG - Intronic
925170890 2:1749844-1749866 CAGAACTCCAGGGGAAGTGCTGG + Intergenic
925990717 2:9252003-9252025 CAGATGTACTTGGGAAGTACTGG + Intronic
927020334 2:19010087-19010109 CTGAAGTCCATGGGACATGGCGG + Intergenic
927392089 2:22607133-22607155 CCGAAGGCCTGGGGAGGTGCTGG - Intergenic
928428448 2:31198701-31198723 CTGGAGTACTTGGGAAGAGTTGG + Intronic
929019625 2:37538691-37538713 CTGAAGTCCTTGAGAAGAAGGGG + Intergenic
932654193 2:73594463-73594485 CTTGTGTCCTTTGGAAGTGCAGG + Intronic
935702462 2:105824434-105824456 CAGAAGTACTTGGGAAAGGCAGG + Intronic
935712692 2:105913274-105913296 CTGGAGTCACTGGGAAGAGCTGG + Intergenic
937047879 2:118861798-118861820 CTTAAGTCCTGGGGAAGGCCTGG - Intergenic
938923841 2:136020603-136020625 CTGGAGATCTTGGTAAGTGCTGG + Intergenic
942458909 2:176156451-176156473 AGGAAGTCTTTGGGAAGTGGTGG + Intronic
943436358 2:187869312-187869334 CTGGAGACCTGGGGAAGAGCGGG - Intergenic
944105968 2:196079882-196079904 CTGAAGTATTTGTCAAGTGCTGG + Intergenic
944322086 2:198357999-198358021 ATGAAGTCCTAAAGAAGTGCAGG - Intronic
945595752 2:211789429-211789451 CTGCAGTCCTTCTGAATTGCAGG + Intronic
1168907179 20:1415856-1415878 CTCAATTCCTTGGCAAGTCCTGG - Intergenic
1171135525 20:22691496-22691518 CTGATGTGCTTAGTAAGTGCCGG - Intergenic
1171145097 20:22774637-22774659 CTGAAGTCCCCAGGAAGAGCAGG + Intergenic
1171158075 20:22895114-22895136 CTGAAGTCTTTGTGACTTGCAGG - Intergenic
1171771307 20:29325213-29325235 CTGAAATCCTTGGGATGCTCAGG - Intergenic
1171905204 20:30894249-30894271 CTGAAATCCTTGGGATGCTCAGG + Intergenic
1173743991 20:45422560-45422582 CTGTAGTCCTAGGGAAGCGGAGG - Intronic
1174060980 20:47832959-47832981 CTGGAGTCTTGGGGAGGTGCCGG - Intergenic
1174070917 20:47898411-47898433 CTGGAGTCTTGGGGAGGTGCCGG + Intergenic
1177682478 21:24390603-24390625 CTGGAGTCCTTGGAAATGGCAGG - Intergenic
1178763407 21:35425999-35426021 CAGAAGCCCTGGAGAAGTGCTGG - Intronic
1179375239 21:40844918-40844940 CTGAACTCCTTGGAAAGGCCTGG - Intronic
1179475568 21:41641377-41641399 CTGAGGTCATTGGAAAGTGCTGG - Intergenic
1179589247 21:42395177-42395199 CTGCAGATCTAGGGAAGTGCAGG + Intronic
1179770542 21:43612167-43612189 TTTAAATCCTTGGGAAATGCTGG - Intronic
1179883624 21:44304206-44304228 CTGAAGACATTTGGAAGTGAGGG + Intronic
1180316690 22:11283059-11283081 CTGAAATCCTTGGGATGCTCAGG - Intergenic
1180338635 22:11600453-11600475 CTGAAATCCTTGGGATGCTCAGG + Intergenic
1182934816 22:34210875-34210897 CTGGAGACCTTGGGAAGTGGAGG - Intergenic
1183369043 22:37422138-37422160 CTGAAGTGCATGGGTACTGCTGG - Intronic
1184287824 22:43481889-43481911 CTGAAAGGCTTGGTAAGTGCAGG - Intronic
1184813782 22:46855150-46855172 CTGAGGTTGCTGGGAAGTGCTGG + Intronic
1185102537 22:48849352-48849374 CCTCAGTCCCTGGGAAGTGCTGG + Intronic
954653210 3:52177851-52177873 CTGTAGGCAGTGGGAAGTGCTGG + Intergenic
954974656 3:54681792-54681814 CTCAGCTCCTTGGGAAGTGGAGG - Intronic
955060944 3:55490905-55490927 CTGAAGTCCTTGGGACTAGACGG - Intergenic
956267328 3:67411941-67411963 CTGAAATCCCTGGGCAGGGCTGG + Intronic
959805188 3:110542809-110542831 TTGAAGTCACTGGGAATTGCAGG - Intergenic
962834857 3:139181135-139181157 CTGGAGTCCTTGGGAAGTATGGG + Intronic
966541880 3:181101128-181101150 CTTAAGTCCTTGGGACAAGCAGG + Intergenic
967225297 3:187285386-187285408 ATCAAGTATTTGGGAAGTGCAGG - Intronic
967420875 3:189271121-189271143 CTAAAGTCCTTGGGAAATGACGG + Intronic
970194791 4:13543192-13543214 CTGGAGTTCTTCGGAAGGGCGGG - Intronic
971171688 4:24240253-24240275 CAGAAGTCCTTAGGAAGTTCTGG + Intergenic
971734017 4:30422724-30422746 CTGAAGTAATTTGTAAGTGCTGG + Intergenic
972271240 4:37512306-37512328 CTGTAATGCTTGGGGAGTGCTGG - Intronic
975695068 4:77004550-77004572 CTGAAGTCATTGCTAAGTGGTGG - Intronic
977195165 4:94049287-94049309 TTGAAGTTCTTTGGGAGTGCAGG - Intergenic
980011699 4:127602543-127602565 ATCTAGGCCTTGGGAAGTGCAGG - Intergenic
982101831 4:151975723-151975745 CTGAAATGCCTGGGAAGTGATGG - Intergenic
982306659 4:153939312-153939334 CAGAAGTCCTAGGTAAGTTCTGG - Intergenic
984605880 4:181785739-181785761 CTGAAATACTTGGGAACTACAGG - Intergenic
985391923 4:189498829-189498851 CAGAGATCCTTGTGAAGTGCTGG - Intergenic
987715824 5:21568870-21568892 CTGTAGTGCTTGGGTAATGCTGG + Intergenic
990056562 5:51587853-51587875 CTGCTGTCCTTGGGGAGTGATGG + Intergenic
993523953 5:88941498-88941520 CTGAAGAGCTTGGGAATTCCAGG + Intergenic
994056201 5:95418965-95418987 ATGAAGACCTTGGTAAGTGTAGG - Intronic
994219771 5:97182411-97182433 GTGAAGTCCTTGGAAAGAGTTGG - Intronic
994558551 5:101336036-101336058 ATGATGTCCTTTGGAAGTTCTGG + Intergenic
994627536 5:102240120-102240142 ATTAAGTCCCTGAGAAGTGCAGG - Intronic
994649640 5:102510473-102510495 CTAGAGTCCTTGGGGAGTCCTGG - Intergenic
995355041 5:111227625-111227647 CTGAAGCCCCTGGATAGTGCTGG + Intronic
996001126 5:118365049-118365071 CTGAAGTACTTTGGTAGTGAAGG + Intergenic
997479025 5:134169028-134169050 ATGAAGCCCTGGGGAACTGCAGG + Intronic
997858009 5:137390759-137390781 CTGAACTCCTCTGGAAGTGCTGG - Intronic
998153323 5:139769615-139769637 CTGAAGGGCTGGGCAAGTGCTGG - Intergenic
998358087 5:141558371-141558393 AGGAATTCCTGGGGAAGTGCAGG - Intronic
999267650 5:150277340-150277362 CGGAAGGCGTTGGGCAGTGCTGG - Intronic
999698306 5:154205492-154205514 CTGCAGTCCTTGGGAAAGCCTGG - Intronic
1000005179 5:157176525-157176547 ATGATGTCCTTGGGATGTGGTGG - Intronic
1004266714 6:14154287-14154309 CTGAATTCCTTTGGAGGTGGGGG + Intergenic
1005041512 6:21604507-21604529 CTGAAGTTCCTGGGAAGTTGTGG + Intergenic
1005772837 6:29093163-29093185 CTGAAGTCCTTGGCACTGGCTGG - Intergenic
1006132707 6:31878671-31878693 CTGAGGTCCTTGGGAGGAGGGGG - Intronic
1006618558 6:35346289-35346311 CTGAAGGGCTTGGAAATTGCAGG + Intronic
1008939218 6:57028612-57028634 CTGAAGGGCCTGGGAAGTGCAGG - Intergenic
1008942748 6:57064841-57064863 CTGAAGGGCCTGGGGAGTGCAGG - Intergenic
1010146994 6:72681959-72681981 CTCAAGTCCTGGGGAACTCCAGG - Intronic
1010465870 6:76166267-76166289 CTGAAGTCCTCAGGCAGGGCAGG - Intergenic
1010916779 6:81628820-81628842 CAGAGGTCCTTGGGGAGGGCTGG + Intronic
1011101570 6:83728162-83728184 CTGTAGTCCCTGGGAAGGGAAGG + Intergenic
1012386094 6:98685016-98685038 CTGAAGACCCAGGGAAGAGCTGG - Intergenic
1015008939 6:128319684-128319706 GTGAAGTGTTTGGTAAGTGCTGG - Intronic
1015456557 6:133433144-133433166 CTGAACTTCTTGTGAATTGCTGG + Intronic
1017023959 6:150165440-150165462 CTAAAGTCCTTGGGGAAGGCTGG + Intronic
1017532980 6:155314814-155314836 CGGAAGCCCTTGGGAACTTCAGG - Intergenic
1019526059 7:1481034-1481056 CTGAAGTCCTTGGGAAGTGCTGG - Intronic
1021577167 7:22115317-22115339 CTGTAGAACTTGGGAAGGGCAGG + Intergenic
1022638998 7:32163739-32163761 CTGACCTCCTTGGGCAGTGGTGG - Intronic
1023137708 7:37069409-37069431 ATGAAGTGGTTGGGAAGTGATGG - Intronic
1025097357 7:56106571-56106593 CTGAAGTTCATTGGAAGAGCAGG + Exonic
1025610779 7:63073935-63073957 CTGACTTCCTGGGGAATTGCTGG + Intergenic
1029026238 7:97419657-97419679 CTGAAGTCTTAGGGAAAAGCAGG + Intergenic
1029340387 7:99939022-99939044 CTCTATTCCTTGGGAAGTCCTGG - Intergenic
1031852863 7:126886786-126886808 CTGTAGTACTTGGGAATTGAGGG - Intronic
1034421381 7:150992889-150992911 CTGAAGTGCCTGGAGAGTGCTGG + Intronic
1036462196 8:8963348-8963370 CACAAGTCCTTGGAAAGCGCAGG + Intergenic
1037893376 8:22636012-22636034 GGGAGGTCCTTGGGAAGTGGGGG - Intronic
1041735864 8:61109860-61109882 GTGGAGTCCTGGGGCAGTGCAGG - Intronic
1043309843 8:78844408-78844430 CTGAACTCCTTGGGAAGCAGAGG - Intergenic
1044695473 8:94918305-94918327 CTGGAAACCCTGGGAAGTGCAGG - Intronic
1047441218 8:124880256-124880278 CTGGGGCCATTGGGAAGTGCTGG + Intergenic
1047660339 8:127026829-127026851 CTGAAGATCTTGGAAAGAGCTGG + Intergenic
1048330951 8:133470586-133470608 CTGAGCTCCTTGGGAAGCACGGG + Intronic
1048465802 8:134664010-134664032 CTGAAGTGCCTGGGAAGTTACGG + Intronic
1048998792 8:139810937-139810959 CTAAAGTAGATGGGAAGTGCTGG - Intronic
1049028405 8:140013617-140013639 GTGATGTCCTTCGGGAGTGCTGG + Intronic
1049470171 8:142771803-142771825 CGGAGGTCCTGGGGAAGTGGGGG - Intronic
1053311448 9:37023383-37023405 CTGGAGTCCATAGGAAGTACAGG - Intronic
1053479154 9:38403109-38403131 CTGTAGACCTTGGTAAGAGCAGG + Intergenic
1054776767 9:69130588-69130610 TTGGAGGCCTTTGGAAGTGCAGG + Intronic
1055174054 9:73296199-73296221 CTCAAGTCCTTGAGAAGTTCTGG - Intergenic
1058904707 9:109473278-109473300 CTGAAGCCCCTGGGAAGCCCGGG + Intronic
1059189796 9:112314153-112314175 TTGGGGTCCTTGGGAAGTACTGG + Intronic
1061070008 9:128303732-128303754 AGGAAGTCCCTGGGAAGAGCTGG + Intergenic
1062168977 9:135123880-135123902 CAACAATCCTTGGGAAGTGCTGG + Intergenic
1062422987 9:136492979-136493001 CTGCAGACCCTGGGAACTGCAGG - Intergenic
1203364996 Un_KI270442v1:248994-249016 CTGAAATCCTTGGGATGCTCAGG - Intergenic
1185641937 X:1593139-1593161 CTGCAGGCCTTGGGAGCTGCTGG + Intronic
1186607460 X:11106937-11106959 ATGAAGTTCATGGGCAGTGCTGG + Intergenic
1186844007 X:13512959-13512981 CTTCAGTCCTGGGGAAGTGGGGG + Intergenic
1189358060 X:40326663-40326685 CAGAAGTCATTGGCAAGTACAGG + Intergenic
1189565524 X:42237303-42237325 AAGTAGTCCTTGGGAAGAGCAGG - Intergenic
1193847896 X:86497479-86497501 GTCATGTCCTTGGGAAGAGCAGG + Intronic
1197246256 X:124170272-124170294 TTAAAGGCCTTGGAAAGTGCAGG + Intronic
1197451642 X:126627017-126627039 CTTAATTCCTTTTGAAGTGCAGG + Intergenic
1197977473 X:132181188-132181210 CTGAAGCTCTGGGGAAGTGGTGG - Intergenic