ID: 1019526968

View in Genome Browser
Species Human (GRCh38)
Location 7:1484871-1484893
Sequence CCCTGGGCTGGCGGCTTCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 244}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019526968_1019526973 -9 Left 1019526968 7:1484871-1484893 CCCAAGAAGCCGCCAGCCCAGGG 0: 1
1: 0
2: 1
3: 23
4: 244
Right 1019526973 7:1484885-1484907 AGCCCAGGGCACTGCACCACTGG 0: 1
1: 0
2: 1
3: 30
4: 256
1019526968_1019526978 10 Left 1019526968 7:1484871-1484893 CCCAAGAAGCCGCCAGCCCAGGG 0: 1
1: 0
2: 1
3: 23
4: 244
Right 1019526978 7:1484904-1484926 CTGGCCCCTTACCCTCCCCAGGG 0: 1
1: 0
2: 6
3: 42
4: 373
1019526968_1019526977 9 Left 1019526968 7:1484871-1484893 CCCAAGAAGCCGCCAGCCCAGGG 0: 1
1: 0
2: 1
3: 23
4: 244
Right 1019526977 7:1484903-1484925 ACTGGCCCCTTACCCTCCCCAGG 0: 1
1: 0
2: 6
3: 27
4: 353
1019526968_1019526982 15 Left 1019526968 7:1484871-1484893 CCCAAGAAGCCGCCAGCCCAGGG 0: 1
1: 0
2: 1
3: 23
4: 244
Right 1019526982 7:1484909-1484931 CCCTTACCCTCCCCAGGGCAGGG 0: 1
1: 0
2: 7
3: 47
4: 398
1019526968_1019526980 14 Left 1019526968 7:1484871-1484893 CCCAAGAAGCCGCCAGCCCAGGG 0: 1
1: 0
2: 1
3: 23
4: 244
Right 1019526980 7:1484908-1484930 CCCCTTACCCTCCCCAGGGCAGG 0: 1
1: 1
2: 4
3: 56
4: 578

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019526968 Original CRISPR CCCTGGGCTGGCGGCTTCTT GGG (reversed) Intronic
900087227 1:904406-904428 GCCGGGGCCGGCGGCCTCTTTGG - Intergenic
900532972 1:3163686-3163708 CCTGGGGCTGCCGGCATCTTTGG + Intronic
901040534 1:6360432-6360454 CCCTGGGATGCCGGCTACTCAGG - Intronic
902079841 1:13813490-13813512 CCCTGGGCTTTCAGCTCCTTAGG - Intronic
902940927 1:19799821-19799843 CCGTGGCCTGGCGGCTCCTCCGG + Intronic
902984805 1:20148891-20148913 GCCTGGGGTGGTGGCTACTTTGG + Exonic
902985507 1:20152054-20152076 GCCTGGGCTGCAGGCTTCTCGGG - Intergenic
903226299 1:21895835-21895857 TCCTGGGCTGAGGGCTCCTTGGG - Intronic
903657743 1:24959404-24959426 CCCTTTGATGGCGGCTTCTGAGG - Intronic
903668097 1:25020321-25020343 GCCTGTGCTGGAGGCTTCCTGGG - Intergenic
905773013 1:40650267-40650289 CACTGGGCTGGGGGCTCCTGAGG + Intronic
906159850 1:43640026-43640048 CCCTGGGGAGGGGGCTTCTGAGG - Intergenic
911663404 1:100528254-100528276 CCCTGTGCTTGCAGCTTGTTGGG - Intergenic
912658326 1:111507398-111507420 CCCTGGCCTGGGGCCTACTTGGG + Intronic
916996077 1:170302556-170302578 CCCTGAGCTGGCAGCAGCTTGGG + Intergenic
917836608 1:178946293-178946315 CTCTGGGATGGCGCCGTCTTTGG + Intergenic
919718973 1:200811232-200811254 CCCTGTGGTGGCAGTTTCTTTGG + Intronic
920448617 1:206039559-206039581 CCCTGGGTGGGAGGCTTCTGGGG + Intronic
921265006 1:213414940-213414962 CCCTGGGATTGCTGATTCTTTGG + Intergenic
923051189 1:230392538-230392560 CCCTGGGAGGGCAGCTGCTTTGG + Intronic
1062795881 10:344888-344910 ATCTGGGCAGGCCGCTTCTTTGG + Exonic
1063424857 10:5942839-5942861 CACTGTGCTGGCCGCTTCCTGGG - Intronic
1066480951 10:35795033-35795055 GCCTGGGCTGGCAGCTTTTCAGG + Intergenic
1067299370 10:44995017-44995039 CCCTGGCCTGGAAGATTCTTGGG - Exonic
1068860650 10:61844706-61844728 GCCTGGGGTGGCGGCTTCCCTGG - Intergenic
1069721802 10:70554550-70554572 CCCTGGGCTGGCGGCCATGTTGG - Intronic
1070305241 10:75235504-75235526 CCCTGGGCTTCCGGCTTCCCTGG - Intronic
1070587217 10:77775421-77775443 CCCTGGGCAGGAGGGATCTTGGG - Intergenic
1071600695 10:86957485-86957507 CCCTGGGCTGGGGGCTGCTGGGG - Exonic
1072223771 10:93349307-93349329 CCCTGGGATGGCACCTTCTTTGG - Intronic
1072454356 10:95562842-95562864 CCGTGGGCTGGGGGCTCCCTAGG - Intergenic
1072695001 10:97596528-97596550 CCCAGGGCTGGCAGCTTTTACGG + Intronic
1075156092 10:119977181-119977203 CCCTGCGCTGGTGCCTGCTTTGG + Intergenic
1076591367 10:131586033-131586055 CCCTGGGCTGGGGTCTTTCTAGG + Intergenic
1076621654 10:131792849-131792871 CTCTGGGCTCCTGGCTTCTTTGG - Intergenic
1076741256 10:132486850-132486872 CCCTGGGATGTCGGCTTTTGGGG + Intergenic
1078091667 11:8268158-8268180 CGCAGGGCTGGCGGCCTCGTTGG + Intronic
1078391872 11:10941980-10942002 CCCTGGTCTGGCTACTTCTCTGG - Intergenic
1080015965 11:27506907-27506929 ACCTGGACTTGCGGCTTTTTAGG + Intergenic
1083633724 11:64109080-64109102 CCCTGGGATGGGGGCATCTCAGG - Intronic
1085018887 11:73192629-73192651 CCCTTGGCTGGGGGCTTCTTAGG - Intergenic
1088903685 11:114137962-114137984 TGCTGTGCTGGCAGCTTCTTAGG + Intronic
1089190450 11:116649489-116649511 CCCTTGGCTCAGGGCTTCTTGGG + Intergenic
1089352267 11:117828409-117828431 CCCTGGGCTGGTGGCATGTGAGG + Intronic
1089454698 11:118619195-118619217 CCCTGAGCTGGTGGCTTTCTGGG - Intronic
1092667197 12:10815876-10815898 CCCTGGGCTGGCTTCTTCCATGG + Intergenic
1094266318 12:28564607-28564629 CCCTGGGCTGCCGTCTGCATGGG - Intronic
1094719771 12:33052357-33052379 CCCTGGGCTGGCAGCTCCCTGGG - Intergenic
1097842879 12:64339112-64339134 CTCAGGCCTGTCGGCTTCTTTGG + Intronic
1102317290 12:111899508-111899530 CCCTGGACTGTCAGCCTCTTTGG - Intergenic
1102420575 12:112800051-112800073 CACTGGGCTGTCGGCTTCAGGGG - Intronic
1103141661 12:118554026-118554048 CCCAGGGCAGGCTGCTTCCTGGG + Intergenic
1103527178 12:121576839-121576861 CCCTGGGCTAGCAGCTTCAGTGG - Intronic
1103702001 12:122853132-122853154 TCCTTGGCTGGCAGCTTCTCTGG - Intronic
1104516183 12:129429447-129429469 CCCTGGGGGGGCCTCTTCTTTGG - Intronic
1105039718 12:132953245-132953267 CCCTGGAGGGGCGGCCTCTTGGG - Intronic
1110282759 13:73714530-73714552 CCCTGCTCTATCGGCTTCTTTGG + Intronic
1113848072 13:113403671-113403693 CCCTGAGGGGGCGGCTTCCTGGG + Intergenic
1113987907 13:114333762-114333784 CACTGGGTTGGCGGCTTAGTAGG - Intergenic
1115238320 14:31229939-31229961 CCTAAGGCTGGCGGCTTGTTAGG - Intergenic
1116263983 14:42663743-42663765 CCATGGTCAGGCAGCTTCTTTGG - Intergenic
1117793160 14:59362174-59362196 GCCTGGGGTGGAGGCTTCTGGGG + Intronic
1118837189 14:69485458-69485480 CCCGGGGTTGGGGGCATCTTTGG - Intronic
1120145959 14:80978601-80978623 CCCTGGGCTGTGGGCTTCCCGGG + Intronic
1122074597 14:99227979-99228001 CCCTGGGCTGGCAGCATCCCAGG - Intronic
1122975874 14:105170504-105170526 CCCCGGGCTGGGGGCTCCTGAGG - Intergenic
1124621700 15:31277652-31277674 GCCTGGGCCTGCAGCTTCTTTGG + Intergenic
1125519674 15:40340770-40340792 CCTTTGGCAGGGGGCTTCTTGGG - Intronic
1125579557 15:40775763-40775785 CCCTGGGGTGGCAGCTTCTCTGG - Intronic
1125744385 15:41988784-41988806 CCGTGGGCTGGGGGCTTCTGGGG + Intronic
1128149590 15:65355011-65355033 CCCTGGCCTGGCAAGTTCTTGGG + Intronic
1129112371 15:73344873-73344895 CCCTGGGATGGCTGGTGCTTGGG - Intronic
1129253242 15:74320008-74320030 CCCTGGGAGGGCAGCTTCTGTGG + Intronic
1129364778 15:75047574-75047596 CCCTGGGCTGGGGGCCGCCTGGG - Intronic
1129817288 15:78565884-78565906 CCGTCGCCTGGCGGCTTCCTGGG - Intronic
1130550791 15:84888890-84888912 GCCTGGGGTGGAGGCTGCTTGGG + Intronic
1130896090 15:88171475-88171497 CCCTGGGTTTGAGGCGTCTTTGG - Intronic
1131851706 15:96550571-96550593 CCCTGGGAAGGGGGCTTCATTGG - Intergenic
1131907657 15:97161475-97161497 CCCTGGCCTGGCTGCTTTTTTGG + Intergenic
1132550944 16:553626-553648 CCCTGGGCTGGCAGCTCCCTGGG - Exonic
1132654374 16:1035796-1035818 CCCTGGGCTGGCGGCTGTGGGGG - Intergenic
1132743964 16:1429070-1429092 CCCTGGGCTGTGGGCTCCCTGGG + Intergenic
1137290612 16:47049650-47049672 CACTGGGCTGGGGGATTCTTTGG - Intergenic
1137676536 16:50306412-50306434 CCCTGAGTTGGGGGCTTCCTAGG + Intronic
1139505092 16:67394642-67394664 CCCTGGGCTCGCCGCTGCTCGGG + Exonic
1139563590 16:67758978-67759000 CCCTGGGCTGGCAGCACCCTCGG - Intronic
1140748727 16:78004077-78004099 CTCTGGGCTGGAGGCTTCTCTGG - Intergenic
1141395504 16:83701033-83701055 CCCTGAGCTGGGGGATTCTAGGG + Intronic
1142183892 16:88685516-88685538 ACCTGGCTTGGCAGCTTCTTGGG - Intronic
1142698817 17:1647674-1647696 CCCTAGCCTGGCCGCTTCTAGGG - Intronic
1143158077 17:4851501-4851523 CCCTGCGATGGGGACTTCTTTGG + Intronic
1144707954 17:17382113-17382135 TCCTGGGGTGGCAGTTTCTTTGG - Intergenic
1145930735 17:28683433-28683455 CCCTGGGCTGGCGACTCTCTGGG + Intronic
1146456985 17:33016118-33016140 CACTGGGGTGGCAGCTGCTTGGG + Intronic
1146720186 17:35118657-35118679 CCCTGGGATGCCAGCTTCTACGG - Intronic
1147164886 17:38587768-38587790 CCCTGGGCTGGGGGCATCACTGG - Intronic
1147325367 17:39667366-39667388 GCCTGGCCTGGCCGCTCCTTCGG + Intergenic
1148655209 17:49278125-49278147 CCCTGGGATGGCCCCTTCCTTGG - Intergenic
1149846495 17:60011664-60011686 CGATGGGCTGGGGGCTTCTCAGG - Intergenic
1149865229 17:60147889-60147911 GCCTGGGCTGGCAGCTTTATGGG + Intergenic
1150084843 17:62268239-62268261 CGATGGGCTGGGGGCTTCTCAGG - Intergenic
1150708603 17:67510449-67510471 CCCTGGGCTGGCTTTTGCTTTGG + Intronic
1152021064 17:77780615-77780637 CCCTGAACTTGCTGCTTCTTGGG + Intergenic
1152495603 17:80669138-80669160 CCAGGGGCTGGGGGCTTCTGGGG + Intronic
1152605196 17:81286089-81286111 CCCTGGGCTGTGGGCTGCTGAGG - Intronic
1152668051 17:81582940-81582962 CCCTGGCCGGGAGGCTCCTTGGG - Intronic
1152805880 17:82356072-82356094 TCCTGGGCTGGTGCCTTCCTGGG - Intergenic
1156517047 18:37688883-37688905 CCCTTGGCTTCTGGCTTCTTGGG + Intergenic
1160431900 18:78818683-78818705 CCCTTGGTGGGCAGCTTCTTGGG - Intergenic
1160696050 19:484981-485003 GCCTGGGCTGGGGGCTGCTGTGG + Intergenic
1160955003 19:1687062-1687084 CCCTGGGCTGGGGGCTTCGGGGG + Intergenic
1160986280 19:1840474-1840496 CTCTGGGCTTGGGGCTGCTTGGG - Intronic
1161046149 19:2136022-2136044 GCCTGGGCGGGAGTCTTCTTGGG - Intronic
1161046163 19:2136067-2136089 ACCTGGGCGGGAGTCTTCTTGGG - Intronic
1161867407 19:6843298-6843320 CTCTGGGCTGGGGGCTGCTGGGG + Intronic
1162039302 19:7960188-7960210 CCCTGGGCTGCCGGCTCCAAAGG + Exonic
1163577106 19:18117506-18117528 CCCCAGGCTGGGGGCTCCTTAGG - Intronic
1163586678 19:18168204-18168226 GCCTGGGCTGGCATCTTCTTGGG + Intronic
1163828632 19:19537396-19537418 CGCTGCGCTGGCCGCTTCTCCGG + Exonic
1164048969 19:21567882-21567904 CCCTGGCCTGGAGGCCTCTCTGG - Intergenic
1164095999 19:22010551-22010573 CCCTGGCCTGGAGCCCTCTTGGG - Intronic
1164115499 19:22215406-22215428 CCCTGGCCTGGAGCCCTCTTGGG - Intergenic
1164199175 19:23002783-23002805 CCCTGGCCTGGAGCCCTCTTGGG - Intronic
1164296537 19:23915216-23915238 CCCTGGCCTGGAGCCCTCTTTGG + Intronic
1164673181 19:30084714-30084736 CCCAGGGCTGTGGGCTTCCTTGG + Intergenic
1165581106 19:36864577-36864599 CCCTGGGAGGGCGTCTTCCTCGG - Intronic
1166817688 19:45556817-45556839 CCCTGGGCTTGTGGGTTCCTGGG + Intronic
1168508466 19:56955660-56955682 CCCGGGGCCGGGGGCTCCTTGGG - Intergenic
925619800 2:5781406-5781428 CCCTGGGTAGGAGGCTTCGTGGG - Intergenic
925996739 2:9299643-9299665 TCCTGGGCTGGCTGCTTTCTAGG - Intronic
927706864 2:25301791-25301813 CCCTGGGTTGGCCCCTCCTTGGG - Intronic
927882805 2:26700499-26700521 TCCTGGGCTGGTGGCCTCTCTGG + Intronic
927946032 2:27135750-27135772 TCCTGGGCTGGTGGCTTGGTGGG + Intergenic
929261014 2:39866543-39866565 CCCAGGGCAGGCTGCTTTTTGGG + Intergenic
932033746 2:68218933-68218955 CCCTGGACTGGTTGGTTCTTAGG - Intronic
932672469 2:73750384-73750406 CCCTGGGCAGGCAACTTCTGAGG - Intergenic
932675810 2:73779981-73780003 CATTGGGTGGGCGGCTTCTTGGG - Exonic
933728092 2:85437746-85437768 CGCTGCGCTCGCGGCTTCTGCGG - Intergenic
933759638 2:85664826-85664848 CCCTGGGCTGGCGGGGCCATTGG + Intronic
937040685 2:118818336-118818358 CTGTGGGCTGGAGGCTGCTTGGG - Intergenic
937092348 2:119214787-119214809 CCCTGGGATGGCAGCTGGTTGGG - Intergenic
946402831 2:219477515-219477537 TCCAGGGCTGGCTGCTTCCTGGG - Intronic
948588940 2:239037382-239037404 TCCAGGGCTGGCGGATTCCTAGG + Intergenic
948889505 2:240900131-240900153 TCGTGGGCTGGGGGCTACTTTGG + Intergenic
1171293322 20:23994899-23994921 CCCAGGGCTGGTGGTTGCTTTGG - Intergenic
1173687257 20:44932333-44932355 GCCTGGGCTGGAGGCTGCATGGG - Exonic
1175989949 20:62783625-62783647 CCCTGGGCAGGCTGCCTCCTGGG + Intergenic
1176980101 21:15371883-15371905 CCCTGGCCTGGCTGCTCTTTAGG - Intergenic
1177300884 21:19244704-19244726 TCCGTGGCTGGCGGCTTCGTGGG + Intergenic
1179591466 21:42412142-42412164 CCCTGGGGAGGCTGCTTCCTGGG - Intronic
1180032949 21:45224573-45224595 CCCTGGGCAGGGGGCTACTGGGG + Exonic
1180045252 21:45302169-45302191 CCCAGGGCTGGCGGTTGCTGAGG + Intergenic
1180084981 21:45504467-45504489 CCCGGGGGCGGCGGTTTCTTCGG + Exonic
1180132834 21:45837549-45837571 CCCTGGGTTGTCTGCCTCTTGGG + Intronic
1180616500 22:17131730-17131752 CCCTTGGGTGGCAGCTTCTGTGG - Exonic
1180824383 22:18852614-18852636 CCCAGGGCTGGTGGTTGCTTTGG - Intronic
1181124809 22:20695768-20695790 CCCAGGGCTGGTGGTTGCTTTGG - Intergenic
1181188351 22:21121934-21121956 CCCAGGGCTGGTGGTTGCTTTGG + Intergenic
1181210847 22:21288559-21288581 CCCAGGGCTGGTGGTTGCTTTGG - Intergenic
1181398662 22:22638329-22638351 CCCAGGGCTGGTGGTTGCTTTGG + Intergenic
1181501394 22:23317685-23317707 CCCAGGGCTGGTGGTTGCTTTGG + Exonic
1181546809 22:23606885-23606907 CCCTGGCCAGGCAGCTTCGTGGG + Intergenic
1181650759 22:24257730-24257752 CCCAGGGCTGGTGGTTGCTTTGG - Intergenic
1181706623 22:24653009-24653031 CCCAGGGCTGGTGGTTGCTTTGG + Intergenic
1182696911 22:32204201-32204223 CCCTTGGCTGGGGGCTGGTTGGG - Intergenic
1182704924 22:32271087-32271109 GCAGGGGCTGGCTGCTTCTTCGG - Intergenic
1183409806 22:37648251-37648273 CCCTGGGCTGGAGAATTCTCAGG + Intronic
1184443993 22:44536494-44536516 TGCTGGGCTGGAGGCTTCCTGGG + Intergenic
1184569049 22:45310483-45310505 CCCGGGCCTGGGGGCTTCTGAGG - Intronic
1185143959 22:49119309-49119331 CTCTGGGCTGCTGGCTTCTTAGG + Intergenic
1185192555 22:49447919-49447941 CGCTGGGCTGGGGGCTTTGTGGG - Intronic
1203216100 22_KI270731v1_random:6871-6893 CCCAGGGCTGGTGGTTGCTTTGG + Intergenic
1203274521 22_KI270734v1_random:78518-78540 CCCAGGGCTGGTGGTTGCTTTGG - Intergenic
949533708 3:4979568-4979590 CCCTGGGCTGCTGGAATCTTCGG - Exonic
950525179 3:13519038-13519060 CCCTGGAGGGGCGGCTTCCTGGG + Intergenic
952788267 3:37176630-37176652 CCTTGGGCGGGTGGCTTCTCTGG + Intronic
954697587 3:52435865-52435887 CCCCGGGCTGGGGGCTCCTCTGG + Exonic
961213225 3:125141483-125141505 CCCTGGGTAGGCGGCTGCTAGGG + Intronic
964616561 3:158672675-158672697 CCCTGGGCTGACTGCTTCTGAGG + Exonic
965628665 3:170708038-170708060 CTCTAGGCTGTCAGCTTCTTTGG + Intronic
968441584 4:627062-627084 CCCTGGGCTGGCAGCCTGGTGGG - Intronic
968481977 4:837267-837289 CCCTGAGCTGGCGGGTTCATGGG - Intergenic
968510445 4:993210-993232 CCCTGGACTCGTGGTTTCTTAGG - Intronic
968620539 4:1601721-1601743 CCCTGGGCTGTGAGCTCCTTGGG + Intergenic
968689337 4:1982615-1982637 GCCAGGGCTGGGGGCTTCCTAGG - Intergenic
968870787 4:3241084-3241106 CCCTGGGGTGGCGTCTGCCTAGG + Exonic
968879610 4:3292466-3292488 CCCGGAGCTGGCGGCAGCTTCGG - Intergenic
968952978 4:3704095-3704117 GCCGTGGCTGGCGGCTTCCTGGG + Intergenic
969486096 4:7473318-7473340 CCCTGGGCTGAGGGCTCCCTGGG - Intronic
970332714 4:15002602-15002624 CCCAGCGCCGGCGGCTTCCTAGG + Intergenic
975690523 4:76958279-76958301 CCCTGGGATGGCAACTCCTTTGG - Intronic
975849910 4:78561427-78561449 CCCAGGGCTGGTGTCTTCTATGG - Intronic
977419900 4:96786243-96786265 CCCTGGGCAAGAGGGTTCTTTGG - Intergenic
981739583 4:147988118-147988140 CCTGAGGCTGGCTGCTTCTTAGG + Intronic
985770549 5:1807552-1807574 CCCTGCCCTGCCGGCCTCTTGGG - Intronic
986385378 5:7228042-7228064 CCCTGGGCAGGGGGCTGCCTTGG + Intergenic
990304658 5:54482387-54482409 CCCTTGGCTGGTGACATCTTGGG - Intergenic
992457170 5:76926497-76926519 CCCTGGACTGGCTGCTCCTCAGG + Intergenic
992760881 5:79950114-79950136 TCCTGGGCTTGAAGCTTCTTTGG + Intergenic
997989405 5:138531631-138531653 CCCTGGGATGAAAGCTTCTTGGG - Intronic
998173603 5:139886659-139886681 CCTTGGACTAGCGGCTTCTCTGG + Intronic
998370780 5:141659678-141659700 GCCTGGGCTGGGGGCTTGTTGGG + Intronic
998411735 5:141916337-141916359 CCCTGTGCTGGCTGACTCTTGGG - Intergenic
999165404 5:149545315-149545337 CCCTGGGCTGCCGTCTTTATGGG - Intronic
1001167595 5:169384829-169384851 CACTGGGCTGGCTGCTTTTGTGG + Intergenic
1004288440 6:14344763-14344785 TCCTGTCCTGGCGGCTTCTTGGG - Intergenic
1004884933 6:20042388-20042410 CCCTGGGCTGCCGTCTGCATGGG - Intergenic
1006166873 6:32070389-32070411 CCCTGGGCTGGCGTCACCTCGGG + Intronic
1006454206 6:34122704-34122726 CCCCGGGCTGGCGGCTTCCCCGG + Intronic
1007159635 6:39778579-39778601 CACTGGGCTAGAGGCTGCTTTGG + Intergenic
1012041877 6:94216343-94216365 CCCTCGCCTGACGGTTTCTTGGG + Intergenic
1017883716 6:158581092-158581114 CCCTTGCCTTGCGGCTTCTCAGG + Intronic
1019496077 7:1341257-1341279 CCCATGGCTGGGGACTTCTTTGG + Intergenic
1019526968 7:1484871-1484893 CCCTGGGCTGGCGGCTTCTTGGG - Intronic
1019918355 7:4147762-4147784 CTCAGGGCTGTCGGCTTCTCAGG + Intronic
1020254878 7:6497509-6497531 CCGTGCTCTGTCGGCTTCTTGGG - Intronic
1024308145 7:47945381-47945403 CCCTCTGGTGGCGGCTTCTTGGG - Intronic
1025222951 7:57132040-57132062 CCCTGGACTGGAGGCCTCTCTGG - Intronic
1025263566 7:57438535-57438557 CCCTCGCCTGGCAGCTTCTCAGG + Intergenic
1025281634 7:57629843-57629865 CCCTGGTCTGGAGCCTTCCTGGG + Intergenic
1025303096 7:57835672-57835694 CCCTGGTCTGGAGCCTTCCTGGG - Intergenic
1025633748 7:63303704-63303726 CCCTGGACTGGAGGCCTCTCTGG - Intergenic
1025648948 7:63444464-63444486 CCCTGGACTGGAGGCCTCTCTGG + Intergenic
1025719772 7:63999224-63999246 CCCTGGACTGGAGGCCTCTCTGG + Intergenic
1025742303 7:64207466-64207488 CCCTGGGCTGGAGCCCTCTCTGG + Intronic
1026793784 7:73352621-73352643 CCCTGGGTCGGTGGCTGCTTGGG - Intronic
1029115399 7:98233894-98233916 CCCAGTGCCGGCTGCTTCTTCGG - Exonic
1029221101 7:98991109-98991131 CCCTGGGCTGTCCGCTTCCCCGG - Intronic
1029515384 7:101020242-101020264 CCCTGGGATGGGGGCCTCTTGGG - Intronic
1032262040 7:130346148-130346170 CCCAGGGCTGCTGGCTACTTTGG + Intronic
1032658745 7:133960093-133960115 CTCTGGGCTAGCTGCTTCCTAGG - Intronic
1032705146 7:134414936-134414958 CACTGGGCTGGAGGCTCCTGTGG + Intergenic
1035260531 7:157659044-157659066 CCCCGGGCTGCCGGCTTCCTTGG + Intronic
1035605213 8:926118-926140 TCCTGGGCTGGCCGGTTCCTGGG + Intergenic
1036656968 8:10683088-10683110 TCCTGGGCTGCCTGCTTCTCAGG - Intronic
1037575429 8:20197814-20197836 CCCTAGGCTGGAGCCTTCTTAGG + Intronic
1037888008 8:22605082-22605104 CCCGGCGCTGGCGGCTGCTGAGG + Intronic
1039469946 8:37807163-37807185 CCCTGGGCTGGACGCTTGTCAGG - Intronic
1040640098 8:49323303-49323325 CCCTGGGCTGGCTGCTGCAGAGG - Intergenic
1041708914 8:60875607-60875629 CCCTGGGCAGGAGGCATTTTGGG - Intergenic
1043388348 8:79768639-79768661 CCCTGGGCTGGTGGCCACTGTGG - Intergenic
1044807353 8:96021661-96021683 CCGTGGGCTGGCTGCTTTTCAGG + Intergenic
1046965684 8:120163079-120163101 GCCTGGACTGGCGCCTTCTGGGG - Intronic
1047423714 8:124727678-124727700 CACTGGGCGGGTGGCTTCTCTGG - Intronic
1047922746 8:129652164-129652186 CCCTGGGCTGGCTGCTTTCGGGG - Intergenic
1048974589 8:139664054-139664076 CCTTGGGCAGGCGGCTTGATCGG - Intronic
1049706785 8:144046794-144046816 CCCGGAGCTGGCGGCGTCTGAGG + Exonic
1049767557 8:144361987-144362009 TCCTGGGCTGGGTGGTTCTTGGG + Intergenic
1049774325 8:144397564-144397586 CAGGGGGCTGGCTGCTTCTTCGG + Exonic
1053002732 9:34586182-34586204 CCCAGGGCTGGCTGCATCCTAGG + Intronic
1058651852 9:107182156-107182178 CCCTGGGCAGGCCAGTTCTTGGG - Intergenic
1060029970 9:120205875-120205897 GGCTGGGCTGGCTGCTTCTCTGG - Intergenic
1061284815 9:129616149-129616171 CCCTGGGCTGGATGCTTGTACGG - Intronic
1061386745 9:130295038-130295060 CCCGGGGCTGGCCTCCTCTTTGG + Intronic
1061546858 9:131309485-131309507 CCCTGTGCTGGCTGCTACCTGGG + Intergenic
1061882476 9:133575152-133575174 CCCTCGGCTGGGGGCTGCTGGGG - Exonic
1061920044 9:133777704-133777726 ACCAGGGCTGCCAGCTTCTTGGG - Intronic
1062020256 9:134315991-134316013 GCCAGGCCTGGCGGCTTCCTGGG + Intergenic
1062112408 9:134789225-134789247 CCCTGGGCAGGCAGCTTGTTCGG + Intronic
1062673947 9:137728968-137728990 TCCTGGGCTGGCTGCTTCTATGG + Intronic
1186774215 X:12847813-12847835 GCCTGGGGTGGCGGAGTCTTGGG + Intergenic
1189794470 X:44634027-44634049 CCAAGGCCTGGTGGCTTCTTGGG + Intergenic
1189911054 X:45810845-45810867 CCCTGGCATGGTGGCCTCTTCGG - Intergenic
1191881593 X:65848295-65848317 GCCTGGGCAGGTGGCTTGTTTGG + Intergenic
1192001382 X:67155564-67155586 CTCTGGGCTGCAGGTTTCTTTGG - Intergenic
1192634682 X:72806147-72806169 CCTAGGGCTGGGGGCTTGTTGGG - Intronic
1192647031 X:72914654-72914676 CCTAGGGCTGGGGGCTTGTTGGG + Intronic
1202177171 Y:22108559-22108581 CCCTGAGATGGAGGCTTTTTGGG - Intergenic
1202214190 Y:22477825-22477847 CCCTGAGATGGAGGCTTTTTGGG + Intergenic