ID: 1019526968

View in Genome Browser
Species Human (GRCh38)
Location 7:1484871-1484893
Sequence CCCTGGGCTGGCGGCTTCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 244}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019526968_1019526977 9 Left 1019526968 7:1484871-1484893 CCCAAGAAGCCGCCAGCCCAGGG 0: 1
1: 0
2: 1
3: 23
4: 244
Right 1019526977 7:1484903-1484925 ACTGGCCCCTTACCCTCCCCAGG 0: 1
1: 0
2: 6
3: 27
4: 353
1019526968_1019526973 -9 Left 1019526968 7:1484871-1484893 CCCAAGAAGCCGCCAGCCCAGGG 0: 1
1: 0
2: 1
3: 23
4: 244
Right 1019526973 7:1484885-1484907 AGCCCAGGGCACTGCACCACTGG 0: 1
1: 0
2: 1
3: 30
4: 256
1019526968_1019526978 10 Left 1019526968 7:1484871-1484893 CCCAAGAAGCCGCCAGCCCAGGG 0: 1
1: 0
2: 1
3: 23
4: 244
Right 1019526978 7:1484904-1484926 CTGGCCCCTTACCCTCCCCAGGG 0: 1
1: 0
2: 6
3: 42
4: 373
1019526968_1019526982 15 Left 1019526968 7:1484871-1484893 CCCAAGAAGCCGCCAGCCCAGGG 0: 1
1: 0
2: 1
3: 23
4: 244
Right 1019526982 7:1484909-1484931 CCCTTACCCTCCCCAGGGCAGGG 0: 1
1: 0
2: 7
3: 47
4: 398
1019526968_1019526980 14 Left 1019526968 7:1484871-1484893 CCCAAGAAGCCGCCAGCCCAGGG 0: 1
1: 0
2: 1
3: 23
4: 244
Right 1019526980 7:1484908-1484930 CCCCTTACCCTCCCCAGGGCAGG 0: 1
1: 1
2: 4
3: 56
4: 578

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019526968 Original CRISPR CCCTGGGCTGGCGGCTTCTT GGG (reversed) Intronic