ID: 1019526987

View in Genome Browser
Species Human (GRCh38)
Location 7:1484920-1484942
Sequence CAGCACAGAGACCCTGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 590
Summary {0: 1, 1: 0, 2: 7, 3: 64, 4: 518}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019526987_1019526989 -4 Left 1019526987 7:1484920-1484942 CCCAGGGCAGGGTCTCTGTGCTG 0: 1
1: 0
2: 7
3: 64
4: 518
Right 1019526989 7:1484939-1484961 GCTGACCCCGTCCCCTCCCCAGG 0: 1
1: 3
2: 3
3: 41
4: 519
1019526987_1019527000 13 Left 1019526987 7:1484920-1484942 CCCAGGGCAGGGTCTCTGTGCTG 0: 1
1: 0
2: 7
3: 64
4: 518
Right 1019527000 7:1484956-1484978 CCCAGGGCCACACTGCCGGCTGG 0: 3
1: 0
2: 7
3: 43
4: 384
1019526987_1019526990 -3 Left 1019526987 7:1484920-1484942 CCCAGGGCAGGGTCTCTGTGCTG 0: 1
1: 0
2: 7
3: 64
4: 518
Right 1019526990 7:1484940-1484962 CTGACCCCGTCCCCTCCCCAGGG 0: 1
1: 3
2: 3
3: 53
4: 506
1019526987_1019526997 9 Left 1019526987 7:1484920-1484942 CCCAGGGCAGGGTCTCTGTGCTG 0: 1
1: 0
2: 7
3: 64
4: 518
Right 1019526997 7:1484952-1484974 CCTCCCCAGGGCCACACTGCCGG 0: 4
1: 0
2: 12
3: 74
4: 638

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019526987 Original CRISPR CAGCACAGAGACCCTGCCCT GGG (reversed) Intronic
900529776 1:3147436-3147458 CAGCACAGATACACTGCCCAGGG - Intronic
900889421 1:5438697-5438719 CAGCACAGGGACCCTGGGCCGGG + Intergenic
901205947 1:7496033-7496055 CAGCCCAGAGAGCTGGCCCTGGG - Intronic
901658479 1:10784201-10784223 CACCACAGAGACCTTGGTCTTGG + Intronic
902080186 1:13815456-13815478 CAGGACAAAGATCCTGACCTTGG + Intronic
902770845 1:18644679-18644701 GGGCACTGAGATCCTGCCCTTGG + Intronic
902863242 1:19260658-19260680 CAGCAAAGGGACCCTGGACTCGG - Intergenic
903161815 1:21494466-21494488 CCCCACAGAGCCCCTGCACTGGG + Intergenic
903336303 1:22626896-22626918 CAGCCCACAAGCCCTGCCCTAGG - Intergenic
903865005 1:26391688-26391710 CAGCTCAGAGAGGATGCCCTGGG - Intergenic
904786683 1:32988186-32988208 CCGCACAGAGACTCTGGTCTGGG - Intergenic
904947014 1:34206784-34206806 CAGGAGAGAGAGGCTGCCCTGGG + Intronic
905451996 1:38062928-38062950 CAACACAGAGCCCCTCCTCTTGG - Intergenic
906666168 1:47623655-47623677 CAGCAGAGAGAGCCTGGCCTGGG + Intergenic
907419122 1:54334998-54335020 CAGCACAGAGGCACTGCCCCGGG + Intronic
908003428 1:59704202-59704224 CAGAAGAGCGACCCAGCCCTGGG + Intronic
908265860 1:62378440-62378462 CAGCACAGAGAATCTGCCAAGGG - Intergenic
908919240 1:69170077-69170099 CAGCACAGGGACCCTCAGCTCGG - Intergenic
909057917 1:70844936-70844958 CAGCACAGGGACCCTGGGCTTGG - Intergenic
909192560 1:72572891-72572913 CAGCACAGGGACCCTGGACCTGG - Intergenic
910005439 1:82390668-82390690 CAGCACAGCAACCCTGCCAATGG - Intergenic
910034033 1:82768470-82768492 CATCATGGAGAACCTGCCCTTGG - Intergenic
911904357 1:103548078-103548100 CAGCACAGGGACCCTGGGCCCGG + Intronic
912807145 1:112766163-112766185 CAGTTCAGAGACCCACCCCTAGG - Intergenic
913150109 1:116033391-116033413 CAGAGCAGAGGCCCAGCCCTGGG + Intronic
913254241 1:116939508-116939530 CAGCACAGGGACCCTGGACCTGG + Intronic
915164142 1:153939286-153939308 CTGTGCAGGGACCCTGCCCTTGG - Intronic
915804375 1:158829044-158829066 CAGCACAGGGACCCTGGGCCTGG + Intergenic
916734835 1:167598378-167598400 CAGCACGGGGACCCTGGGCTTGG + Intergenic
916924914 1:169508441-169508463 CAGCAAAGAGCCCCTGCACATGG + Intergenic
917578142 1:176345591-176345613 CAGCATTGTGCCCCTGCCCTAGG - Intergenic
918727733 1:187947477-187947499 CAGCACAGGAACCCTGGGCTTGG - Intergenic
918757754 1:188358619-188358641 CTGCACTGAGCCCCTGCCCTAGG - Intergenic
918914423 1:190616364-190616386 CAGCACAGGGACCCTGGGCTTGG + Intergenic
919797962 1:201332594-201332616 AAGGACACAGACTCTGCCCTGGG + Exonic
920076235 1:203339068-203339090 AAGCAAACAGCCCCTGCCCTTGG - Intergenic
920321843 1:205129819-205129841 CATCACAGAAAAACTGCCCTTGG + Intergenic
920896001 1:210049872-210049894 CAGCACAGAGACCCTGGGCCTGG + Intronic
921715986 1:218417712-218417734 CAGCACAGGGACCCTGGGCCAGG - Intronic
922393994 1:225177567-225177589 CAGCACAGAGACCCTGGGTTTGG - Intronic
922858895 1:228798570-228798592 CAGCACACAGCTCCTGCCCTTGG + Intergenic
922865926 1:228861614-228861636 CTGCACAGGGTCCCTGTCCTGGG - Intergenic
923361785 1:233219006-233219028 CAGTGCAGAGGACCTGCCCTGGG + Intronic
1062798878 10:364690-364712 CACCCCAGCAACCCTGCCCTAGG + Intronic
1062992381 10:1832605-1832627 CACCACAGTGTCCCTGCCCCAGG - Intergenic
1063028307 10:2205270-2205292 CAGAACAGAGACCTCGCCCAAGG + Intergenic
1063465797 10:6243496-6243518 CAGCACCCAGAGCCTGCCCAGGG - Intergenic
1065274659 10:24073819-24073841 CAGCACACAGACACTGCCCTAGG + Intronic
1065293195 10:24251448-24251470 CAGATCAGAGGCCCTGGCCTGGG + Intronic
1066269814 10:33811171-33811193 CAGCTCAGTGCCCCTGACCTTGG + Intergenic
1066274633 10:33856747-33856769 CAGCACAGGGAGGTTGCCCTGGG + Intergenic
1066612547 10:37265348-37265370 CATCCCAGAGACCCCACCCTGGG + Intronic
1067090724 10:43264754-43264776 CAGCCCAGCGCCCCTCCCCTGGG + Intronic
1067552156 10:47243740-47243762 CTGCACAGAGTCCCTGGCTTTGG - Intergenic
1068604302 10:58988711-58988733 CAGCACAGAGGCCCTGATCCAGG - Intergenic
1068657895 10:59593390-59593412 CTGCACTGAGACCCTGCCACGGG - Intergenic
1069239684 10:66123875-66123897 CAGCACAGGGACCCTGGGCCTGG + Intronic
1069805165 10:71117816-71117838 CAGCACAGAGACCCTGGGCTTGG - Intergenic
1069836184 10:71309738-71309760 CAGGACAGGGACCCTCCTCTTGG + Intergenic
1069898360 10:71692836-71692858 TAGCACACAGGCCCTGCCCGTGG + Intronic
1069923733 10:71833655-71833677 CAACACAGAGCTGCTGCCCTGGG - Intronic
1070750385 10:78960735-78960757 CAGAACAGAGGCACTGACCTTGG + Intergenic
1070782571 10:79146200-79146222 CAGAGCGGAGACCCTGCTCTAGG - Intronic
1071574685 10:86716622-86716644 CAGCAAGCAGACCCTGCCCCGGG + Exonic
1071970310 10:90898830-90898852 CAGGCCAAAGACCCTGACCTTGG - Intronic
1072158819 10:92747784-92747806 TAGAACCCAGACCCTGCCCTTGG + Intergenic
1072790807 10:98316375-98316397 CAGCACAGTGACTCTGCGCCTGG - Intergenic
1073817598 10:107224522-107224544 CAGCAGAGGGACCCTGGGCTGGG + Intergenic
1073993972 10:109294893-109294915 CAGCACAGGGACCCTGGGCCTGG - Intergenic
1074042924 10:109810118-109810140 CAGCACAGGGACCCTGAGCCTGG + Intergenic
1075655587 10:124158974-124158996 CATCACACAGATCCTGCCCCTGG + Intergenic
1075906113 10:126083392-126083414 CTGCCCAGAGGCCCTGCCCTGGG - Intronic
1076160825 10:128243006-128243028 CTTCACAGAGACCGGGCCCTGGG + Intergenic
1076241001 10:128907345-128907367 CAGCACAGAGACCTGGCCTCTGG + Intergenic
1076588834 10:131569633-131569655 CAGAACAAAGGCCCAGCCCTCGG + Intergenic
1076657914 10:132036767-132036789 CAGCGCAGAGGCCCGGCCCCCGG - Intergenic
1076874442 10:133208713-133208735 CGGCACAGAGACCCTGCGGTGGG - Intronic
1077170469 11:1163785-1163807 CACCCCAGGGACCCGGCCCTGGG + Intronic
1077305308 11:1866322-1866344 CAGCACTGAGTGCCTGGCCTGGG - Intronic
1077395171 11:2316955-2316977 AAGCACAGAGATCCTGGCCTGGG - Intronic
1077735099 11:4782731-4782753 CAGCACAGAGACCTTGGGCCTGG - Intronic
1078892106 11:15566753-15566775 CAACACAGACACCCTGATCTAGG + Intergenic
1079798913 11:24844678-24844700 CAGCACAGGGACCCTGGGCCTGG - Intronic
1080959891 11:37145975-37145997 TAGCACAGAGACCCTGGTCCTGG + Intergenic
1081083266 11:38769024-38769046 CAGCACACTGACCCTGAACTGGG + Intergenic
1081673204 11:44953193-44953215 CAGGACAGTGTCCCTGTCCTTGG + Intergenic
1082766219 11:57169895-57169917 CAGCACAGGGACCCTGGGCCCGG + Intergenic
1082781941 11:57294737-57294759 CAGCACAGAGCCCCTGTGCTGGG + Intergenic
1083078824 11:60069569-60069591 CAGTAGAGACACCATGCCCTAGG - Exonic
1083348624 11:62011784-62011806 CTGCACAGAGACTCTGGTCTGGG + Intergenic
1083725892 11:64627885-64627907 CTGCCCAGAGACCCGGGCCTGGG + Intronic
1083725946 11:64628336-64628358 GAGCACAGAGACACAGCCCATGG - Intronic
1084667263 11:70583099-70583121 CAGCCCAGTGCCCCTGCCCCAGG - Intronic
1084702986 11:70799683-70799705 CCACACAGTGACCCTGTCCTGGG + Intronic
1084955143 11:72687210-72687232 CAGGACACAGACCCTGCCCTTGG - Intronic
1085279201 11:75319316-75319338 CAGCACAGAGACCCGGGACCAGG + Intronic
1085526103 11:77165207-77165229 CAGCACAGAGATCCAGTGCTAGG - Intronic
1085534918 11:77211989-77212011 AAGCACAGAGACTCCTCCCTAGG + Intronic
1085740918 11:79077828-79077850 TGGCAGAGAGAGCCTGCCCTCGG + Intronic
1085941861 11:81214294-81214316 CAGCACAGGGACCCTGGGCCTGG + Intergenic
1086231689 11:84577904-84577926 CAGCACAGGGACCCTGGGCCTGG - Intronic
1086580390 11:88392036-88392058 CAGCACAGGGACCCTGGGCCTGG + Intergenic
1087176750 11:95103509-95103531 CAAGACACAGTCCCTGCCCTTGG + Intronic
1087474591 11:98620264-98620286 CAGCACAGAGACTCTGCGCCTGG - Intergenic
1087496318 11:98894422-98894444 CAGCACAGGGACCCTGGCCCTGG + Intergenic
1087497306 11:98907875-98907897 CAGCACAGGGACCCTGGGCCTGG - Intergenic
1087550241 11:99639259-99639281 CAACACAGAGACCCTGGGCCTGG + Intronic
1090442349 11:126734952-126734974 GTGCACATTGACCCTGCCCTTGG - Intronic
1090660713 11:128879972-128879994 CAGCACAGAAGGCCTGGCCTAGG + Intergenic
1091244588 11:134081397-134081419 CAGCACAGGGACCCTGGGCCCGG - Intronic
1092948188 12:13475987-13476009 CAGAACTCAGACCCTGCCCTGGG + Intergenic
1092997574 12:13964374-13964396 CAGCAAAGAGGCCCTGCCCTTGG + Intronic
1093141879 12:15518330-15518352 CAGCACAGGGACCCTGGGCCTGG + Intronic
1093322382 12:17728757-17728779 CAGAACATACATCCTGCCCTGGG - Intergenic
1094494496 12:30980916-30980938 CAGGACAGGATCCCTGCCCTCGG + Intronic
1094495293 12:30985504-30985526 CAGGACAGAAGGCCTGCCCTGGG - Intronic
1094689528 12:32755362-32755384 CAGCACAGTGAAGCTGCCCCAGG + Exonic
1095226802 12:39686941-39686963 CAGCACTGTGCCCCTGCCCTAGG - Intronic
1096517636 12:52165876-52165898 CAGCACACAGGGCCTGCCTTGGG + Intergenic
1096828652 12:54298160-54298182 CAGTACAAAGATCCTGCCCTAGG + Intronic
1097282062 12:57851133-57851155 CAGCCCCGATACTCTGCCCTGGG - Intergenic
1097570561 12:61326292-61326314 CAGCACAGGGACCCTGGGCCCGG + Intergenic
1098743195 12:74200785-74200807 CAGCACAGGGACCCTGGACCTGG + Intergenic
1099491300 12:83292034-83292056 CAGTACAGAAACTCTGCACTTGG + Intergenic
1099495624 12:83342834-83342856 CTGCACTGTGCCCCTGCCCTAGG + Intergenic
1099858906 12:88204887-88204909 CAGCACAGACACTCTGGGCTTGG - Intergenic
1100291784 12:93222125-93222147 CTGCACAGAGACTTTGCACTGGG + Intergenic
1101702196 12:107184689-107184711 GACCACAGAGACCGTGGCCTAGG + Intergenic
1101988295 12:109464270-109464292 CAGGTTGGAGACCCTGCCCTAGG - Intronic
1102442224 12:112972063-112972085 CAGCAGAGTGGCCCTGGCCTGGG + Exonic
1102720637 12:115013294-115013316 GAGCCCAGAGACCCTGGGCTGGG - Intergenic
1102829764 12:115987092-115987114 CAGGACAAAGACCCTACCGTAGG + Exonic
1103274475 12:119700205-119700227 CAGCCCACAGTCCCAGCCCTGGG - Intronic
1103368277 12:120398934-120398956 CAGCACAGAGAAGGTGCCCAGGG + Intergenic
1103798707 12:123523194-123523216 CGTGACAGAGACCCTGCCCTTGG - Intronic
1104549021 12:129739072-129739094 CAGCTCAAAAACACTGCCCTTGG - Intronic
1104937810 12:132375882-132375904 CTGCACAGAGCCCCAGACCTGGG + Intergenic
1105857515 13:24386120-24386142 CTGGTCAGAGACCCTGCCCATGG - Intergenic
1106037036 13:26052172-26052194 CAGCAGGCAGACCCCGCCCTTGG - Intergenic
1106449433 13:29866722-29866744 AAGCACAGAGGCCATGCCTTGGG + Intergenic
1106565403 13:30880503-30880525 CAGCACAGAGCCACTGTCCCAGG + Intergenic
1107303968 13:38998197-38998219 CAGCACAGATATTCTGTCCTTGG + Intergenic
1107655672 13:42590094-42590116 CATCCCACAGACCCTGTCCTTGG - Intronic
1108359978 13:49660050-49660072 CAGCACATAGACCAGGCCCTTGG - Intergenic
1108603662 13:52016497-52016519 CAGCACAGGGCCCCTGCACCTGG - Intronic
1108936824 13:55891656-55891678 CAGCACAGGGACCCTGGGCCTGG + Intergenic
1109098210 13:58144718-58144740 CAGCAGAGAGACCCTGGGCCCGG - Intergenic
1109099442 13:58161672-58161694 CAGGAAAGAGACCCTGACATAGG - Intergenic
1109337135 13:61007899-61007921 CAGCAGAGGGACCCTGGGCTTGG - Intergenic
1110238876 13:73244948-73244970 CAGCACAGAGAACCTCACCTGGG + Intergenic
1110697653 13:78510499-78510521 TAGCACAGAGCCCCTGTCCTTGG + Intergenic
1111527645 13:89492641-89492663 CAGCAAAGAGACCCTGGGCCTGG + Intergenic
1114081358 14:19203753-19203775 CATCACAGAGAACCTCTCCTGGG + Intergenic
1114812498 14:25917185-25917207 TAGCACAGAGACCCTGGGCCTGG - Intergenic
1114909383 14:27171344-27171366 CAGCACAGAGACCCTGGGCCTGG + Intergenic
1114974993 14:28084649-28084671 CATAAAAGAGACCCTGACCTGGG - Intergenic
1115917584 14:38333502-38333524 CAGGAAAGAGACCATGCCTTAGG + Intergenic
1115958480 14:38808851-38808873 CAGGGCTGAGAACCTGCCCTAGG - Intergenic
1116590144 14:46761394-46761416 CAGCACTGGGACCCTGGGCTTGG + Intergenic
1116986279 14:51223222-51223244 CAGCACAGCGACCCTGGGCCTGG + Intergenic
1117290198 14:54324858-54324880 CAACACAGTGGCCCTGCTCTTGG + Intergenic
1118352445 14:64982907-64982929 CAGGACTGAGACCTGGCCCTTGG + Intronic
1118771045 14:68943052-68943074 CAGCACAGAAACCCTCACCCAGG + Intronic
1118933417 14:70264062-70264084 CAGCACAGGGACCCTGGGCTCGG - Intergenic
1120393987 14:83944485-83944507 CAGCACAGGGACCCTGGGCCTGG + Intergenic
1120469310 14:84902898-84902920 CAGCATTGTGCCCCTGCCCTAGG + Intergenic
1120844635 14:89115197-89115219 CAGCAGAGGTCCCCTGCCCTTGG - Intergenic
1120865626 14:89293268-89293290 CAGCATGGAGAGCGTGCCCTGGG - Intronic
1121332202 14:93056607-93056629 CTGCACTGAGACCCAGCCGTGGG - Intronic
1122055142 14:99092860-99092882 CTGCAGACAGACACTGCCCTGGG + Intergenic
1122083911 14:99286237-99286259 CTGGACACAGACCCTGCCCTCGG + Intergenic
1122118785 14:99540897-99540919 CATCCCAGATACCCTGCACTGGG + Intronic
1122881680 14:104693157-104693179 GAGCACAGGGTCCCTGCCCAGGG - Intronic
1122956684 14:105074584-105074606 CTCCTCAGAGACCCTCCCCTGGG + Intergenic
1202863565 14_GL000225v1_random:100592-100614 CAGCAGAGAGAAACTGGCCTGGG + Intergenic
1125195495 15:37041329-37041351 AAGCACAGAGAACATCCCCTTGG + Intronic
1125501574 15:40242926-40242948 CAGGACAGAGCTCTTGCCCTGGG + Intronic
1126103422 15:45133380-45133402 CACCACACCGACCCTGCCCAGGG + Intronic
1127145033 15:56014856-56014878 CAGCACAGAGACCCTGGGTCTGG + Intergenic
1128562874 15:68680002-68680024 CACCATAGAGACTCAGCCCTGGG - Intronic
1129331206 15:74828304-74828326 CAGCACAAAGCCCTGGCCCTTGG - Intronic
1129469420 15:75742518-75742540 CAGCACAGGGTCCCTGGCCCCGG - Intergenic
1129887555 15:79049204-79049226 CAGGACAGAAACCCAGGCCTGGG - Intronic
1131989508 15:98079824-98079846 GCTCCCAGAGACCCTGCCCTTGG + Intergenic
1132194134 15:99897418-99897440 CAGCACAGGGACCCTGGGCCTGG + Intergenic
1132533731 16:467074-467096 CAGTGCAGAACCCCTGCCCTTGG + Intronic
1132766825 16:1538557-1538579 CAGCTCAGATTCCCTGCCCAGGG - Intronic
1133280513 16:4662567-4662589 CAGCACAGAGACACTGCCTGTGG - Intronic
1133287144 16:4695896-4695918 CAGCTCAGGCCCCCTGCCCTAGG + Intergenic
1133920870 16:10152059-10152081 CATCTCAGACACCCTGCCCCTGG + Intronic
1134158928 16:11868619-11868641 CAGCACACACACTCTTCCCTGGG + Exonic
1134512977 16:14863746-14863768 CAGTGCAGTGGCCCTGCCCTTGG + Intronic
1134700615 16:16262235-16262257 CAGTGCAGTGGCCCTGCCCTTGG + Intronic
1134971210 16:18532424-18532446 CAGTGCAGTGGCCCTGCCCTTGG - Intronic
1136061233 16:27728117-27728139 CAGCGCCCAGACCCTGCCATGGG - Intronic
1136098591 16:27976723-27976745 AAGAACAGAGACCCAGCCATGGG - Intronic
1136516828 16:30773481-30773503 CTGGCCAGAGACCCTGCCGTGGG - Intronic
1136748633 16:32614035-32614057 CTGCCCAGAGGCTCTGCCCTGGG - Intergenic
1136876557 16:33862833-33862855 CAGCAGAGAGTCACTTCCCTGGG + Intergenic
1138241773 16:55433329-55433351 CATGAGAGAGACCCTTCCCTGGG - Intronic
1138396051 16:56705555-56705577 CAGCAGGGAGGGCCTGCCCTGGG + Intronic
1138805706 16:60086221-60086243 CAGCACAGGGACCTTGGACTGGG + Intergenic
1138865291 16:60810979-60811001 CAGGACAGAGACCCAGTCCAGGG - Intergenic
1139430940 16:66910759-66910781 CAGGACAGAGAGCTGGCCCTGGG - Intronic
1139748236 16:69091814-69091836 CATCTCTGAGACTCTGCCCTTGG + Intergenic
1140854336 16:78964792-78964814 CAGCACAGGGACCCAGGGCTGGG - Intronic
1140918780 16:79517930-79517952 TGGCAAAAAGACCCTGCCCTTGG - Intergenic
1141647183 16:85373796-85373818 GAGCACAATCACCCTGCCCTGGG - Intergenic
1141715816 16:85726248-85726270 CAGCACAGAGCTCCTGTCCATGG - Intronic
1142312764 16:89323542-89323564 TAGCTCAGACCCCCTGCCCTCGG - Intronic
1203050766 16_KI270728v1_random:873249-873271 CTGCCCAGAGGCTCTGCCCTGGG - Intergenic
1143020973 17:3917060-3917082 CAGCCGAGAGAGCCTGACCTCGG + Intergenic
1143720056 17:8803117-8803139 GAGCACAGGGAGCCTACCCTGGG - Exonic
1144766870 17:17737932-17737954 AGGCACAGAGACCCTGCCCCTGG + Intronic
1144771165 17:17760442-17760464 CAGCCCAGTGTCCCTGGCCTGGG + Intronic
1145788551 17:27609918-27609940 CAGAACACTGACCCTGCACTTGG - Intronic
1145797751 17:27665773-27665795 GAGCACAGAAGCCCTGGCCTGGG - Intergenic
1145977355 17:28992028-28992050 CAGGCCAGATACTCTGCCCTCGG - Intronic
1146404583 17:32526191-32526213 CAGAACCCAGACCCTGCCCAGGG - Intronic
1146500567 17:33360959-33360981 AAGAACAGTGAGCCTGCCCTGGG + Intronic
1147213381 17:38885220-38885242 AAGGACAGAGACCTTGCCCAAGG - Intronic
1147322134 17:39652958-39652980 AAGCACACAGACACTGCTCTAGG + Intronic
1147326473 17:39672156-39672178 CAGCACAGGATCCTTGCCCTGGG + Exonic
1147330253 17:39695094-39695116 CAGCACAGAGACTCAGACCCTGG + Intronic
1147635186 17:41959651-41959673 CAGAAGAGAGATCCTGGCCTGGG + Intronic
1149260678 17:54876926-54876948 CAGCAAGGAGACCCTGGCCCTGG - Intergenic
1149553580 17:57557576-57557598 CAGCCCAGAGAACCTGTCCCTGG - Intronic
1150440270 17:65185714-65185736 CAGCACAGAGGCAGAGCCCTAGG + Intronic
1150490825 17:65573224-65573246 GAGGGCAGAGACCCTGCTCTTGG - Intronic
1150731245 17:67696939-67696961 CAACTCAGAGACCCTCTCCTGGG - Intronic
1151744314 17:76003486-76003508 CAGGAAAGAGACCCTGGCCTTGG - Intronic
1151758600 17:76088400-76088422 CACCACAGTGACCTGGCCCTGGG - Intronic
1151869253 17:76825474-76825496 CAGGAGAGAGAGGCTGCCCTAGG - Intergenic
1152014530 17:77741787-77741809 CAGCCCTGAGACCCTGCCCTGGG + Intergenic
1152288821 17:79427273-79427295 CACCTCAGGGACCCTGCTCTAGG + Intronic
1152424395 17:80211049-80211071 CAGCACACAGGAGCTGCCCTCGG + Intronic
1152663303 17:81552820-81552842 CAGGGCAGAGACCCATCCCTAGG - Intronic
1152893524 17:82896427-82896449 CAGCACAGCCACCCAGCTCTGGG - Intronic
1152905351 17:82967468-82967490 CAGCACAGTGGCCCTCACCTGGG + Intronic
1152920342 17:83063407-83063429 CAGCACAGAGACCCCACACAGGG + Intergenic
1153140303 18:1964603-1964625 GAGCACAGGGAACCTGCTCTAGG + Intergenic
1153247316 18:3085173-3085195 AATCACAGATACCGTGCCCTGGG - Intronic
1153704730 18:7733872-7733894 CAGAAAAGAGAACCTGCCCAGGG - Intronic
1154297835 18:13165760-13165782 CAGGACTGAGAACCTGCCCCAGG - Intergenic
1154405528 18:14086570-14086592 CACTACAGAGATCCAGCCCTGGG + Intronic
1156775541 18:40783645-40783667 CAGCACAGATAGCCTTCCCAAGG - Intergenic
1157306937 18:46524490-46524512 CAGCACAGTGACCGGGCCCATGG - Exonic
1157548665 18:48565589-48565611 AAGCACAGAGGCCCTGCCCCTGG - Intronic
1158539568 18:58340505-58340527 CAACACAGAGCCCCTTCTCTAGG - Intronic
1158606250 18:58898820-58898842 CAGGTCACAGCCCCTGCCCTGGG - Intronic
1159507990 18:69360618-69360640 CAGCACAGGGACCCTGGGCTTGG - Intergenic
1160765569 19:806106-806128 CAGCACAGACACGGGGCCCTCGG - Intronic
1161145600 19:2676308-2676330 CCCCACAGAGACCCTCCCCTAGG + Intronic
1161277183 19:3425054-3425076 CATCACAGAGACCCCACCCCAGG - Intronic
1161294828 19:3514339-3514361 AAGGGCAGAGACCCTGCTCTCGG - Intronic
1161397304 19:4051678-4051700 CAGCCCGGAGACCTTGCCGTGGG - Intronic
1161595971 19:5151147-5151169 CAGCAGAGGGGCCCTGCACTCGG - Intronic
1161883469 19:6974458-6974480 CTGCATGGAGACCCAGCCCTGGG + Intergenic
1162084805 19:8242071-8242093 CAGCTCAGAGACCTTGCACCTGG - Intronic
1162297424 19:9822860-9822882 CAGCACCAAGACCCTGTGCTTGG + Intronic
1163320372 19:16571485-16571507 CTGCCCAGAGTCCCTGCCCGGGG + Intronic
1163775002 19:19212561-19212583 CAGCGCAGATACCCTTCCATTGG - Intronic
1164218189 19:23169624-23169646 CAGATCAGAAACCCTGCACTGGG - Intergenic
1164388346 19:27795231-27795253 CAGCACAAAGACCCTCTCCAAGG - Intergenic
1164721052 19:30431781-30431803 CAGCGCACAGCCCCTGCCCTGGG - Intronic
1165121197 19:33560017-33560039 ACGCACACAGCCCCTGCCCTTGG + Intergenic
1165306614 19:35006627-35006649 CAGGACATGGCCCCTGCCCTTGG - Intronic
1165681504 19:37779969-37779991 CAGAGCAGAGTCCCCGCCCTCGG - Intronic
1166932245 19:46308449-46308471 GGGGACAAAGACCCTGCCCTGGG + Intronic
1167118258 19:47500804-47500826 AGCCACAGAGACACTGCCCTGGG + Intronic
1168676222 19:58279600-58279622 CACCGCGGAGCCCCTGCCCTGGG + Exonic
926020737 2:9493103-9493125 CAGCACAGACATTCTGCTCTCGG - Intronic
927007563 2:18866318-18866340 AAGCACAGGGACCCTGGACTTGG - Intergenic
927087957 2:19689735-19689757 CAGCATGGATCCCCTGCCCTTGG - Intergenic
929043847 2:37772106-37772128 CAGGACAGAGAGGCTGGCCTGGG - Intergenic
929528854 2:42732457-42732479 CAGCACAGGGACCCTGGGCCTGG + Intronic
929601227 2:43206088-43206110 CAGCCCAGAGACTGTGCTCTGGG + Intergenic
929824231 2:45297710-45297732 CAGCACAAAGCACCTGCCATAGG + Intergenic
930021309 2:47003764-47003786 GGGCACAGAGGCCCTGCCCATGG - Intronic
930484807 2:51998724-51998746 CAGCACAGGGACCCTGGGCCTGG - Intergenic
931376723 2:61714409-61714431 CAGCACAGAGAACATTCCATCGG - Intergenic
932317803 2:70797695-70797717 AGGCACAGAGACTCTGCCCTTGG + Intergenic
933065001 2:77781617-77781639 CAGCACAGGGACCCTGTGCCTGG - Intergenic
933350426 2:81146039-81146061 CAGAACAGGGACCCTGGGCTCGG + Intergenic
933745979 2:85571628-85571650 GAACACAGAGATTCTGCCCTTGG - Intronic
934122319 2:88852312-88852334 CAGCACAGGTACCCAGCCCAAGG + Intergenic
935481409 2:103594672-103594694 CAGCACAGGGACCCTGCACCTGG - Intergenic
935946313 2:108289703-108289725 CAGCACATGGTTCCTGCCCTTGG - Intronic
937295948 2:120810046-120810068 CAGCACAGGGCCCCCGCCCCTGG - Intronic
938127133 2:128682692-128682714 CCACACAAAGACCCTGTCCTGGG + Intergenic
938405752 2:131032250-131032272 AAGGGCAGTGACCCTGCCCTGGG - Intronic
938407076 2:131038676-131038698 CAGAACATAGCCCCTGCCCCAGG + Intronic
938698132 2:133853102-133853124 CGGCACAGGGACCCTGGCCCTGG - Intergenic
938849984 2:135250549-135250571 CAGCACAGGGACCCTGGACCTGG - Intronic
939667586 2:144969743-144969765 CAGCACAGGGACCCTGGGCCTGG + Intergenic
941068675 2:160931766-160931788 CAGCACTGAGACCCTGAATTAGG + Intergenic
941803631 2:169688102-169688124 CAGCACAGGGACCCTGGTCCTGG + Intronic
942054252 2:172167860-172167882 CAGCACAGGGACCCTGGGCCCGG - Intergenic
942176944 2:173343428-173343450 ATGCACAGAGATCCGGCCCTGGG - Intergenic
942780593 2:179637281-179637303 CGACACAGATAGCCTGCCCTAGG + Intronic
943072241 2:183154128-183154150 CAGCACAGGGACCCTGGGCCTGG + Intronic
943491330 2:188559183-188559205 CAGCACAGGGACCCTGGGCCAGG - Intronic
943871729 2:193008457-193008479 CAGCACAGAGACCCTGGGCCTGG + Intergenic
946574285 2:221057369-221057391 CCGCACAGAGACCCTGGGCCCGG + Intergenic
947008479 2:225538554-225538576 CAGCACAGGGACCCTGGGCCTGG + Intronic
947301066 2:228689141-228689163 CTCCCCAGAGACCCTGGCCTGGG + Intergenic
947524913 2:230871930-230871952 CAGCACAGGGGTCCTGCCCTGGG - Intronic
947768235 2:232651118-232651140 CCCCACAGAGCCCCAGCCCTGGG - Intronic
948182564 2:235994041-235994063 TAGCACAGACACCTTCCCCTGGG + Intronic
948599472 2:239100150-239100172 CAGCCCAGAGACTCTGCCTTTGG + Intronic
948699402 2:239750761-239750783 CAGCCCAGGGACGCTGCCCGAGG - Intergenic
948909666 2:240996705-240996727 CAGCGGAGAAATCCTGCCCTGGG + Intergenic
1170337495 20:15286474-15286496 AAAGACAGAGAGCCTGCCCTTGG + Intronic
1170608857 20:17895307-17895329 CAGCACAGAGACTGTCCCCTGGG + Intergenic
1170937816 20:20825023-20825045 CAGAACACAGCCCCAGCCCTGGG - Intergenic
1171310312 20:24140105-24140127 AACCACAGAGGCCCTGCCCTGGG - Intergenic
1171750497 20:29044361-29044383 CAGCAGGGAGATCCTGCCCGTGG + Intergenic
1171777420 20:29382163-29382185 CAGCTCAGAGACCTACCCCTAGG - Intergenic
1172702079 20:36859907-36859929 CAGCCTAGCGACCCTGCTCTGGG + Intronic
1173384503 20:42575192-42575214 CAGCCAAGAGACCCGTCCCTTGG + Intronic
1174176614 20:48649463-48649485 CATCATGGAGACCCTGGCCTTGG + Exonic
1174222978 20:48972159-48972181 CAGCAACGGGACCCTGGCCTTGG - Intronic
1174779010 20:53371274-53371296 CAGTATAGAGACTCTGGCCTAGG + Intronic
1175829120 20:61952423-61952445 ATGCACTGAGACCCTGGCCTGGG + Intergenic
1175870200 20:62205767-62205789 CAGCACAGCAGCTCTGCCCTCGG + Intergenic
1176059087 20:63164362-63164384 CAGGAAGGAGATCCTGCCCTGGG - Intergenic
1176272143 20:64240872-64240894 GAGCACAGACACGCTGCCCCAGG - Exonic
1176299056 21:5090068-5090090 CAGCATAGAGAGCCGGCCCAGGG - Intergenic
1176314713 21:5231554-5231576 CAGCAGGGAGATCCTGCCCATGG - Intergenic
1177939436 21:27390493-27390515 GAGCACAGAGACCTTGGCCCTGG - Intergenic
1178221798 21:30669025-30669047 CAGCACAGAGACACTGGGCTTGG - Intergenic
1178917944 21:36719445-36719467 AAGGACAGAGACCCTGGCCTGGG + Intronic
1179162863 21:38912300-38912322 GACAACAGAGCCCCTGCCCTTGG + Intergenic
1179857969 21:44171880-44171902 CAGCATAGAGAGCCGGCCCAGGG + Intergenic
1179957889 21:44751368-44751390 CAGCACAGGGACCCTGGCGCTGG - Intergenic
1180238423 21:46480572-46480594 TGGCACAGAGACCTTGCCTTGGG + Intronic
1180499415 22:15918933-15918955 CATCACAGAGAACCTCTCCTAGG - Intergenic
1180655582 22:17418171-17418193 CACCACACATACCCTGCCCCAGG + Intronic
1180876179 22:19176281-19176303 CAGCACAGTGTCCCTGCACAGGG + Intronic
1180978875 22:19869337-19869359 CAGCACCGGGTCCCTGCCCATGG - Intergenic
1181362603 22:22349594-22349616 CAGCCCTGCAACCCTGCCCTGGG - Intergenic
1181439891 22:22930334-22930356 CTGCCCAGAGACCCAGGCCTGGG + Intergenic
1181461630 22:23089278-23089300 CAGCACAGAGTCAGTGCCCCCGG - Intronic
1181512593 22:23395528-23395550 CAGCACAGGGTCCCTGTCCCTGG - Intergenic
1181523024 22:23460150-23460172 GACAACAGAGACCTTGCCCTGGG + Intergenic
1184475120 22:44716151-44716173 GGGCACAGAGAAGCTGCCCTGGG + Intronic
1184815604 22:46866774-46866796 CAGCACAGTGATTCTGTCCTAGG - Intronic
1185071805 22:48660755-48660777 CAGAAGAGAGACCCCGGCCTGGG - Intronic
1203295979 22_KI270736v1_random:43503-43525 CAGGACAGAGAGGCTGTCCTGGG - Intergenic
949369462 3:3318588-3318610 CAGCACAGGGACCCTGGGCCTGG + Intergenic
949770386 3:7571068-7571090 CAGCACAGGGATCCTGTCCCTGG + Intronic
950221613 3:11200597-11200619 CAGCACATAGTTCCTGCTCTTGG - Intronic
951793979 3:26517714-26517736 CAGCACAGGGACCCTGGGCCTGG - Intergenic
952237245 3:31492772-31492794 CAGCACAGACATCCTGAACTTGG - Intergenic
952966372 3:38623513-38623535 AAGCACAGTGTCCCTGCTCTAGG - Intronic
953335404 3:42090040-42090062 CAGCAAAGAACCCTTGCCCTGGG - Intronic
954581948 3:51707684-51707706 GAGCCCAGTGCCCCTGCCCTGGG + Intronic
957403052 3:79741891-79741913 CAGCACTGTGCCCCTGCTCTAGG + Intronic
957873083 3:86112544-86112566 CAGCAGAGAGACCCTGGGCCCGG - Intergenic
958879975 3:99658600-99658622 CAGCACTGAGTACCTGCACTTGG - Intronic
960496702 3:118383933-118383955 CAGCACAGGGACCCTGGGCCTGG - Intergenic
960694706 3:120384977-120384999 GAGCAGAGAAAACCTGCCCTAGG + Intergenic
960869374 3:122233452-122233474 CACCACAGGTACCCTGCTCTGGG + Intronic
960995841 3:123339543-123339565 CAACAGGGAGAGCCTGCCCTGGG + Intronic
961451384 3:127003849-127003871 CTGGACAGAGACCCAGCCCTAGG - Intronic
961618543 3:128204730-128204752 CAGCACACTTACCATGCCCTGGG - Intronic
961789397 3:129364964-129364986 CAGCACAGGGACCCTGGGCATGG + Intergenic
962659411 3:137586013-137586035 CAGCACAGAAACCCTGGGCCTGG + Intergenic
962672868 3:137726787-137726809 CAGCACAGGGACCCTGGGCCTGG + Intergenic
963279422 3:143367648-143367670 CAGCACAGAGAGCCAGCCCACGG + Intronic
963593030 3:147286711-147286733 CAGCACAGAGACCCTGGGCCTGG + Intergenic
963716648 3:148811499-148811521 CAGCACAGGGACCCTGGGCCCGG - Intronic
963952799 3:151221488-151221510 CAGCACAGAGACCCTGGGCTGGG - Intronic
964520718 3:157563641-157563663 CAGCACAGGGACCCTGGCCCTGG + Intronic
965386860 3:168056095-168056117 CAGCACAGGGACCCTGGGCCTGG - Intronic
965869495 3:173249306-173249328 CAAGACAGAGACCCTGCAGTGGG + Intergenic
965897463 3:173594955-173594977 CAGCACAGGGACCCTGAGCCTGG + Intronic
965968943 3:174529839-174529861 CAGCACAGAGACCCTGGGCCCGG + Intronic
967908278 3:194519966-194519988 CAGCACGGAGACCCTGGGCCTGG - Intergenic
967989590 3:195121111-195121133 CAGCACACCGGCCATGCCCTTGG + Intronic
968135308 3:196216311-196216333 CACCACGAAGCCCCTGCCCTGGG - Intronic
968265543 3:197360303-197360325 CAGCACAGAGACCCTGGGCCTGG - Intergenic
968451683 4:678928-678950 CAGCACAGCAGCCCTGACCTTGG + Intronic
968749693 4:2381904-2381926 CAGCACAGGGACCCTGGGCCTGG - Intronic
968759953 4:2437503-2437525 CAGCCCTGAGACCCTGCACAGGG + Intronic
969301850 4:6301636-6301658 CACCACAGAGAAGCTGGCCTTGG - Exonic
969365855 4:6694001-6694023 CAGCACGCAGACCCTGACCAAGG + Exonic
969572893 4:8020419-8020441 CAGCCCAGATCCCCTGCCCAGGG + Intronic
969582303 4:8072413-8072435 CACCAGAGAGGCCCTGGCCTGGG - Intronic
969955295 4:10883545-10883567 CAGCACAGAGTCCCTGGACTGGG + Intergenic
970357376 4:15269393-15269415 CAGCAGAGGGACCCTGGGCTTGG - Intergenic
970437440 4:16049056-16049078 CAGCACAGGAACCCGGCCCATGG - Intronic
971510428 4:27417190-27417212 CAGCACAGGGACCCTGGGCCTGG - Intergenic
971765007 4:30819266-30819288 CAACACAGAGAGCCAGGCCTAGG - Intronic
972002706 4:34058739-34058761 CAGCACAGCAACCCTGGGCTTGG + Intergenic
972849822 4:43035363-43035385 CAGCAAAGAGACCCTGGACCTGG - Intergenic
972857146 4:43120643-43120665 CAGCACAGGGACCCTGGGCTTGG + Intergenic
973930107 4:55783575-55783597 TAAGACAGATACCCTGCCCTTGG + Intergenic
974269646 4:59633624-59633646 CAGCACTGGGACCCTGGGCTTGG + Intergenic
975729261 4:77321443-77321465 CAGCACAGGGACCCTGGGCCTGG + Intronic
976092166 4:81470522-81470544 CAGTTCAGAGACCCTCCCTTCGG + Intronic
976286463 4:83375680-83375702 CAGCACAGGGACCCTGGGCCTGG + Intergenic
976635642 4:87284371-87284393 CAGCAGAGGGACCCTGGCCCTGG - Intergenic
978915721 4:114124228-114124250 CAGCACAGGGACCCTGTGCCTGG + Intergenic
978939033 4:114415362-114415384 CAGCAGAGGGACCCTGGGCTGGG - Intergenic
979923037 4:126524920-126524942 TAGCACAGAGACCCTGGGCCTGG + Intergenic
980906087 4:138950028-138950050 GTGCGCAGAGCCCCTGCCCTCGG - Intergenic
981027920 4:140095126-140095148 CGTCACAGAGTACCTGCCCTTGG + Intronic
981799371 4:148637610-148637632 CAGCACAGGGACCCTGGGCCTGG + Intergenic
982192905 4:152876757-152876779 CAGCACAGGGACCCTGGGCCTGG - Intronic
982223443 4:153144049-153144071 CAGCCCACAGACGCAGCCCTTGG + Intergenic
982952388 4:161716140-161716162 CAGGAAATAGACCCTGCCATAGG + Intronic
983489152 4:168368211-168368233 CAGCACAGGGACCCTGGGCCTGG - Intronic
984431902 4:179661039-179661061 CACCACAGAGAGCCTCCACTAGG + Intergenic
984443531 4:179804472-179804494 CACCAAAGATATCCTGCCCTGGG + Intergenic
984483143 4:180331646-180331668 CATCACAGAGACTCTGCAGTAGG - Intergenic
984774244 4:183466950-183466972 CAGCACAGGGACCCTGGCCCTGG - Intergenic
985337740 4:188914253-188914275 CAGCACAGGGACCCTGGGCCTGG + Intergenic
985875906 5:2593823-2593845 CAGCACAGGGCCCCTCCACTTGG + Intergenic
985875969 5:2594137-2594159 CAGCACAGACGCACTCCCCTGGG + Intergenic
985913330 5:2899316-2899338 AAGCGCTGAGAACCTGCCCTGGG + Intergenic
986266393 5:6194914-6194936 CAGCAGGAAGACCCTGCCATAGG - Intergenic
986455329 5:7912511-7912533 CAGCAGAGAGACCCTGGGCCTGG + Intergenic
986518736 5:8591213-8591235 CAGCTCAGAAATCCTTCCCTTGG - Intergenic
987511706 5:18847892-18847914 CAGCAGAGGGACCCTGCGCCAGG + Intergenic
987655432 5:20800202-20800224 CAGTACAGGGACCCTGGACTAGG - Intergenic
987792095 5:22581237-22581259 CAGCACAGGGACCCTGGGCCTGG - Intronic
988149934 5:27364519-27364541 CAGCACAGGGACCCTGGGCCTGG - Intergenic
988426884 5:31074495-31074517 CAGCACAGGGACCCTGGGCCAGG + Intergenic
989532529 5:42524734-42524756 CAGCACAGGGACCCTGGGCCTGG - Intronic
990075781 5:51844086-51844108 CAGCACAGGGACCCTGGGCCGGG + Intergenic
991313887 5:65277670-65277692 AAGCATACAGACCCTGCCCTTGG - Intronic
993293773 5:86108938-86108960 CAGCACAGGGACCCTGGGCCTGG - Intergenic
994548696 5:101204844-101204866 CAGCACAGGGACCCTGAGCCTGG - Intergenic
994637718 5:102363578-102363600 CAGCACAGGGACCCTGGGCCAGG + Intergenic
996157019 5:120114805-120114827 CAGCACTGTGCCCCTGCTCTAGG + Intergenic
996641599 5:125761595-125761617 CAGCACAGGGACCCTGGGCCTGG - Intergenic
996967330 5:129321384-129321406 CAGCACAGAGACCCTGGGCCTGG + Intergenic
997233311 5:132258672-132258694 GAGGACTCAGACCCTGCCCTTGG + Intronic
997504602 5:134407186-134407208 ATGTACAGAGCCCCTGCCCTGGG - Intronic
999473662 5:151878593-151878615 CAGCACAGGGACCCTGGGCTTGG - Intronic
999669403 5:153945358-153945380 CAGCACAGGGACCCTGGGCCTGG + Intergenic
1001763685 5:174227841-174227863 CAACAAAGAGACCCTGCCGGAGG + Intronic
1001857646 5:175026684-175026706 CAGCACAGAGCCCCTTCTCAGGG - Intergenic
1001951300 5:175818384-175818406 CAGAGCAGAGACCCTGTCCCAGG + Intronic
1001966148 5:175911185-175911207 GAGGACAGGGACCCTGCCCAAGG + Intergenic
1001990509 5:176112410-176112432 CTGCCCAGAGGCTCTGCCCTGGG - Intronic
1002226363 5:177725730-177725752 CTGCCCAGAGGCTCTGCCCTGGG + Intronic
1002250797 5:177928017-177928039 GAGGACAGGGACCCTGCCCAAGG - Intergenic
1002267484 5:178045483-178045505 CTGCCCAGAGGCTCTGCCCTGGG - Intronic
1002356199 5:178630997-178631019 CAGCTCTGAGACCCTTTCCTTGG - Intergenic
1003231013 6:4253855-4253877 CAGCACAGAGCCCCTTGGCTGGG + Intergenic
1003778089 6:9391924-9391946 CAGCACAGATCCCCTAGCCTTGG - Intergenic
1004105584 6:12664738-12664760 CAGCACAGACACTGTGCCCAGGG + Intergenic
1004645182 6:17553722-17553744 CAACACAGAGGACCTGCCATGGG + Intronic
1004697194 6:18044483-18044505 CAGCACAGAGAGCATGCAATGGG - Intergenic
1005813330 6:29532129-29532151 CAGCATTGAGACCCTCCCCAAGG + Intergenic
1006295484 6:33168329-33168351 CTGCACACACACCCTGCCCCGGG + Intronic
1006408390 6:33858014-33858036 CAGCTCAGAGACCCAGAGCTAGG + Intergenic
1007357542 6:41332475-41332497 CAGCACAGAGACCGGGGCCCTGG + Intergenic
1008650064 6:53552741-53552763 CAGCACGGAGACCCTGGGCCTGG - Intronic
1008783069 6:55130664-55130686 AAGCACATAGAACCTGGCCTTGG + Intronic
1010884330 6:81217969-81217991 CAGCACAGGGACCCTGGGCCTGG - Intergenic
1010891114 6:81312203-81312225 CTGGTCACAGACCCTGCCCTGGG + Intergenic
1011026023 6:82870039-82870061 CAAAACAGAGACCCTTCCCTTGG + Intergenic
1011101395 6:83726919-83726941 AAGGACAGAGACCCTGCCCTGGG + Intergenic
1011152552 6:84290243-84290265 CATCACAGAGACCCTGGACCTGG + Intergenic
1011170916 6:84503716-84503738 CAGCACAGGGACCCTGGACCTGG - Intergenic
1011515311 6:88146990-88147012 CAAGAAAGAGTCCCTGCCCTTGG + Intronic
1012960365 6:105615605-105615627 CAGTTCAGAGACCCACCCCTAGG + Intergenic
1013012325 6:106132032-106132054 CAGCACAGCGAACATGCCCAGGG - Intergenic
1013086612 6:106863056-106863078 CAGCACAGGGACCCTGGGCCTGG - Intergenic
1013211675 6:107992341-107992363 TGGCAGAGAGACCCTGCTCTGGG + Intergenic
1014525879 6:122501359-122501381 CATCACAGAGAACCTCCACTAGG - Intronic
1016139744 6:140594196-140594218 CAGCACAGGGACCCTGAGCCTGG - Intergenic
1016244618 6:141967290-141967312 TAGCACAGAGACCCTGGGCCAGG + Intergenic
1016874103 6:148847779-148847801 CAACACAGAGAGCCTGTTCTGGG + Intronic
1017547581 6:155468469-155468491 CAGCACAGGGACCCTGGGCCTGG + Intergenic
1018834138 6:167470719-167470741 CCTCATAGAGTCCCTGCCCTGGG - Intergenic
1018860063 6:167704722-167704744 CAGCACAGAGCTCCTGCCCGGGG + Intergenic
1018866936 6:167753513-167753535 CAGCACAGGGACCCTGGGCCTGG + Intergenic
1019255164 7:45024-45046 TAGCACATACACCATGCCCTGGG - Intergenic
1019270857 7:147791-147813 CATCAGAGAAACGCTGCCCTTGG - Intergenic
1019312444 7:369364-369386 CAGCACGGAGAGGCTGCCCTGGG - Intergenic
1019525981 7:1480758-1480780 CAACACAGAGACCCAGCCTGGGG - Intronic
1019525994 7:1480792-1480814 CAGCACAGAGACCCAGCCTGGGG - Intronic
1019526987 7:1484920-1484942 CAGCACAGAGACCCTGCCCTGGG - Intronic
1019588308 7:1816413-1816435 GACAACAGAGACCTTGCCCTGGG - Intronic
1020248246 7:6447439-6447461 CAGCGCCGAGACCTGGCCCTGGG - Intronic
1021256994 7:18404922-18404944 CAGCTCAGGGAACCAGCCCTGGG + Intronic
1022561031 7:31349711-31349733 AAGCATAGAGACCTTGCCCAGGG - Intergenic
1022629634 7:32072453-32072475 CAGCAGAGAAACAGTGCCCTGGG + Intronic
1023357538 7:39382383-39382405 CAGCACAGAGACTCAGACCTGGG + Intronic
1024814825 7:53256666-53256688 CAGCACAGGGACCCTGGGCCTGG - Intergenic
1025149835 7:56539472-56539494 CAGCACAAAGACCCTCTCCAAGG - Intergenic
1025260197 7:57413403-57413425 CAGCATGGAGACCCTTCCCAAGG - Intergenic
1025639367 7:63352959-63352981 CAGCACAAAGACCCTCTCCAAGG + Intergenic
1025643332 7:63395133-63395155 CAGCACAAAGACCCTCTCCAAGG - Intergenic
1025712792 7:63927485-63927507 CAGCACAAAGACCCTCTCCAAGG - Intergenic
1026532529 7:71212143-71212165 CAGCACAGGGACCCTGGGCCAGG - Intronic
1026873092 7:73865136-73865158 CAGCCCAGAGAGCCTGGCCCAGG - Exonic
1027147206 7:75704014-75704036 CAGCATGGAAGCCCTGCCCTGGG + Intronic
1027624723 7:80531902-80531924 CAGTATGGAGACCCTACCCTGGG - Intronic
1027681109 7:81222897-81222919 CAGCACAGGGACCCTGGACCAGG - Intergenic
1027996739 7:85434460-85434482 CAGCAGAGAGACCCTGGGCCTGG - Intergenic
1030144721 7:106341481-106341503 CAGCACAGGGACACTGGGCTTGG + Intergenic
1030700933 7:112639549-112639571 CAGCACAAAGACCCTAGCCCAGG - Intergenic
1032455974 7:132073847-132073869 CAGCACAGAGAGCAGGCCCCGGG - Intergenic
1032997974 7:137469566-137469588 CAGCACAGAGGCTCTCTCCTCGG - Exonic
1033833037 7:145276321-145276343 CAGCACAGGGACCCTGGGCCAGG - Intergenic
1034895210 7:154872126-154872148 CTGCACAGAGGCACTGCCATGGG + Intronic
1035221300 7:157407972-157407994 CAGCACACAGGCCATGCCCGCGG - Intronic
1035352042 7:158253879-158253901 CGGCACAGAGCCACTGCCCACGG + Intronic
1035352055 7:158253953-158253975 CAGCACAGAGCCACTGCCCACGG + Intronic
1035352069 7:158254027-158254049 CAGCACAGAGCCACTGCCCACGG + Intronic
1035352083 7:158254101-158254123 CAGCACAGAGCCACTGCCCACGG + Intronic
1035352115 7:158254252-158254274 CGGCACAGAGCCACTGCCCACGG + Intronic
1037898914 8:22676167-22676189 CAGCAGAGGGGCCCTCCCCTGGG + Intergenic
1038239906 8:25798738-25798760 TAGCACAGAGACCCTTTCCCAGG - Intergenic
1039030062 8:33299349-33299371 CAGCACAGAAACCATGCCAGTGG + Intergenic
1039601404 8:38841315-38841337 CAGCACTGTGGCACTGCCCTTGG + Intronic
1040530732 8:48264484-48264506 CAGCACAGAGAATCTGACTTAGG + Intergenic
1040967060 8:53093252-53093274 CAGGACTGAGAACTTGCCCTGGG + Intergenic
1041090784 8:54299346-54299368 CAGCCCAGAAGCCCAGCCCTCGG - Intergenic
1041573648 8:59367932-59367954 CACCAAAGGGGCCCTGCCCTAGG - Intergenic
1043587039 8:81781546-81781568 CAGGAAACAGATCCTGCCCTAGG - Intergenic
1044784668 8:95781520-95781542 CAGCACAGGGACCCTGGGCCTGG - Intergenic
1045195018 8:99921942-99921964 CACCAAAAAGACCATGCCCTAGG - Intergenic
1045800686 8:106097295-106097317 CAGTCCAGAGGGCCTGCCCTAGG + Intergenic
1046877998 8:119277483-119277505 CTGCAAAGACACCCTGCCCAAGG - Intergenic
1047045476 8:121047968-121047990 AACCACAGAGACCCTGAACTTGG - Intergenic
1047194884 8:122712492-122712514 CAGCACAGGGACCCTGGGCCTGG - Intergenic
1047865846 8:129023609-129023631 CAGCACAGGGACCCTGGACCTGG - Intergenic
1048011056 8:130456655-130456677 CAGCTCATTGACCCTGCCCCAGG + Intergenic
1048600926 8:135917906-135917928 TAGCACAGAGACCCTTCCTGAGG - Intergenic
1048879631 8:138861637-138861659 CAGAACAGAAACCCTGCCACAGG + Intronic
1049492230 8:142911567-142911589 CTGCACAGAGGCCCTGGCCAGGG + Exonic
1049616425 8:143577589-143577611 CAGCACGGAGCCCCGGCGCTGGG + Intronic
1049934133 9:484401-484423 CAGCACAGTGCCTCTGCTCTGGG + Intronic
1050043805 9:1522886-1522908 TAGGACATAGTCCCTGCCCTGGG - Intergenic
1050067140 9:1771824-1771846 CACCACAGAGAGCCTTCACTAGG - Intergenic
1050264083 9:3871689-3871711 CAGCACAGGGACCCTGGGCCAGG + Intronic
1051698866 9:19797608-19797630 GAGCTTAGAGAACCTGCCCTGGG - Intergenic
1052626501 9:30982368-30982390 CAGCACAGACACTCTATCCTGGG + Intergenic
1054827169 9:69585103-69585125 CAAAACAAAGGCCCTGCCCTTGG + Intronic
1055363943 9:75524657-75524679 CAGCACAGGGACCCTGGGCCTGG - Intergenic
1055611474 9:78030467-78030489 CAGTACACAGACCCTTTCCTTGG + Intronic
1056087019 9:83160779-83160801 CAGCACAGGGACCCTGGGCCTGG - Intergenic
1056676208 9:88678986-88679008 CAGCACAGCTGCCCTGCCATGGG - Intergenic
1056797320 9:89667718-89667740 CTCCACAGAGCCCCTGCCTTTGG + Intergenic
1057082487 9:92183445-92183467 CAACACAGAGACCCGTCCCAAGG + Intergenic
1057305991 9:93912315-93912337 GAGCCCAGGGAGCCTGCCCTGGG - Intergenic
1057552943 9:96065370-96065392 CAGCACAGGCAGCCTGCCCCTGG - Intergenic
1057841713 9:98490776-98490798 CTGCACAGAGACCACGTCCTGGG - Intronic
1058283682 9:103150206-103150228 CAGCACAGAGTCCCTGGGCCTGG - Intergenic
1059482344 9:114601066-114601088 CAGCACAGGGACCCTGGGCCTGG + Intergenic
1059711053 9:116868065-116868087 CTGGACTGAGACACTGCCCTGGG + Intronic
1060103224 9:120857770-120857792 CAGCAGAGAGACGCAGGCCTTGG + Exonic
1060510458 9:124228554-124228576 CAGGACACAGGCCCTGGCCTTGG + Intergenic
1061484635 9:130914147-130914169 CAGCACTGAGGCCCAGGCCTGGG + Intronic
1062014323 9:134283707-134283729 CAGTGCCGAGACCCTGTCCTTGG + Intergenic
1062076845 9:134594351-134594373 CAGCCCAGAGACTCCGCCCCAGG + Intergenic
1062438694 9:136559094-136559116 CAGCACTGTGCCCCTGCTCTAGG + Intergenic
1062549772 9:137080635-137080657 CAGCACAGAGGCCCTGATCCGGG - Intronic
1062710061 9:137970619-137970641 CTGCACAGAGCACCTGCTCTGGG - Intronic
1203740760 Un_GL000216v2:175420-175442 CAGCAGAGAGAAACTGGCCTGGG - Intergenic
1187127905 X:16470978-16471000 CATCAAACAGAACCTGCCCTTGG - Intergenic
1187634329 X:21210569-21210591 CAGCATTGAGTCCCTGCTCTAGG + Intergenic
1188346013 X:29066638-29066660 CAGCATAGAACCTCTGCCCTAGG + Intronic
1188387098 X:29574880-29574902 CAGCACTGTGCCCCTGCTCTAGG - Intronic
1189478470 X:41375167-41375189 CAGCACAGTCAGCCTGGCCTGGG + Intergenic
1190088785 X:47419523-47419545 CAGCACAGATGCCCTGCTTTTGG + Intergenic
1191020862 X:55858757-55858779 CAGCACAGGGACCCTGGGCTTGG + Intergenic
1191202865 X:57803371-57803393 CAGCACAGGGACCCTGGGCCTGG - Intergenic
1192309397 X:69997705-69997727 CAGCACAGGGACCCTGGGCCTGG - Intronic
1192956513 X:76076269-76076291 CAGCACAGGGCCCCTATCCTGGG + Intergenic
1193153412 X:78148000-78148022 CAGCACAGGGACCCTGGACCTGG - Intergenic
1193438957 X:81515442-81515464 CAGCACAGGGACCCTGGGCCTGG - Intergenic
1193845660 X:86466910-86466932 CAGCACAGGGACCCTGGACCTGG + Intronic
1194467035 X:94246046-94246068 CAGCACAGGGACCCTGGACCTGG - Intergenic
1194503850 X:94708753-94708775 CAGCACAGGGACCCTGGGCCCGG + Intergenic
1194948101 X:100092124-100092146 CAGCACAGACACTCTGTCCTGGG + Intergenic
1195361133 X:104084825-104084847 CAGCACAGAAACTCTATCCTGGG - Intergenic
1195554896 X:106210638-106210660 CAGCACGGAGACCCTGGGCCTGG + Intergenic
1196287167 X:113896318-113896340 CAGCTCAGAGATTTTGCCCTTGG + Intergenic
1197480189 X:126974297-126974319 CAGCATTGTGCCCCTGCCCTAGG - Intergenic
1197547086 X:127838550-127838572 CAGCACAGGGACCCTGGGCCTGG + Intergenic
1198616402 X:138463102-138463124 CAGCACTGAGAGCTTGCCCCAGG - Intergenic
1199539718 X:148945576-148945598 CAGAACTCAGACCTTGCCCTAGG + Intronic
1201257541 Y:12124035-12124057 CACCATATAGACCCTGCCCTTGG - Intergenic